ARTICLE
INTRODUCTION
The inflammatory reaction in infectious and autoimmune diseases is regulated
by a delicate balance between the pro-inflammatory and anti-inflammatory
cytokines. The IL-1 gene complex contains the genes for IL-1alpha, IL-1beta
and IL-1Ra, of which the first two are strong inducers of inflammation,
while IL-1Ra binds to the IL-1 receptors with high affinity without activating
the cell, thus being an effective antagonist (for a review, see ref. 1).
The genes of the IL-1 complex are polymorphic. In the intron 2 of the
IL-1Ra gene there are variable numbers of a tandem (86-bp) repeat sequence
(VNTR), the most common allele (allele 1) (allele frequency 0.74) containing
4 repeats. Allele 2 contains 2 repeats and its frequency is 0.21 [2].
In several diseases, such as ulcerative colitis, multiple sclerosis, alopecia
areata, diabetic nephropathy and Graves' disease the frequency of allele
2 is increased [3-7]. In the IL-1beta gene there are at least two biallelic
base exchange polymorphisms: at the position 511 in the promoter
region and at the position + 3, 953 in the 5th exon [8, 9]. In the IL-1alpha
gene there is a base exchange at the position 889 and a VNTR polymorphism
in intron 6 [10, 11]. The frequency of the more rare allele (allele 2,
T at the position 889) is increased in juvenile rheumatoid arthritis
[10].
Regardless of the increasing amounts of data demonstrating the clinical
significance of these polymorphisms the biological background of the differences
in the mechanisms of action of these various alleles is still largely
unknown. There are data showing that certain alleles may increase the
production of a given cytokine when peripheral blood mononuclear cells
are activated in vitro, but as the regulatory network does not
probably function in the in vitro artificial conditions, the value
of this information is limited. Measurements of inflammatory cytokine
levels in blood have revealed their role e.g. in the regulation
of septic infections (reviewed in ref. 12). How the genetic polymorphisms
regulate the actual in vivo cytokine levels is known only in few
cases, e.g. Mandrup-Poulsen et al. demonstrated that elevated
levels of IL-1Ra could be detected in diabetic patients who were carriers
of the IL-1Ra allele 2 (ILRN*2) [13]. By testing a higher number of people
we recently demonstrated that this effect of the IL-1Ra allele 2 holds
true also in normal healthy individuals, but we observed that this allele
could function only if the allele 2 of IL-1beta (the rarer allele, T at
the position 511) was simultaneously present [14]. To further analyse
the effect of gene polymorphisms in the regulation of the in vivo
levels, we examined the role of alleles of the IL-1 gene complex on IL-1beta
plasma levels.
METHODS
Blood donors
Blood samples were obtained from The Finnish Red Cross Blood Transfusion
Centre, Tampere. The donors were adults (18-60 years old) and they had
not had any sign of infection during a 2-week period before the blood
donation. Plasma was separated within two hours after the blood donation
and kept frozen until tested.
IL-1beta assay
Plasma IL-1beta levels were measured (in randomized samples) by using
an IL-1beta ELISA-kit (Pelikine, CLB, Amsterdam, The Netherlands). This
was performed according to the manufacturer's instructions. The detection
limit of the assay was 0.4 pg/ml. The inter- and intra-assay coefficient
of variations were 4.2 and 6.8%, respectively.
Analysis of IL-1Ra, IL-1a and IL-1b gene polymorphisms
Genomic DNA was isolated from the blood samples by using the salting
out method [15].
The IL-1Ra exon 2 polymorphism was analysed as described [2]. Briefly,
oligonucleotides 5'CTCAGCAACACTCCTAT3' and 5'TCCTGGTCTGCAGGTAA3' were
used as primers in PCR. Conditions used were: denaturing step of 96°
C for 1 min followed by 35 cycles of 94° C for 1 min, 60° C
for 1 min, 70° C for 1 min and finally 72° C for 5 min. The
PCR products were analysed by electrophoresis on a 2% agarose gel stained
with ethidium bromide. Allele 1 (4 repeats) was 410 bp, allele 2 (2 repeats)
240 bp, allele 3 (3 repeats) 325 bp and allele 4 (5 repeats) 500 bp and
allele 5 (6 repeats) 595 bp.
The base exchange at the position 889 of the IL-1alpha gene was
analysed as previously described [10]. Oligonucleotides 5'-AAGCTTGTT CTACCACCTGAACTAGGC-3'
and 5'-TTACATATGAGC CTTCCATG-3' flanking the polymorphic site were used
as primers in PCR. Conditions used were: a denaturing step of 96°
C for 1 min and then 40 cycles of 94° C for 1 min, 51° C for
1 min, 72° C for 1 min and finally 72° C for 4 min and 55°
C for 5 min. The products were digested with NcoI and the resultant products
were analysed on 9% PAGE. This gave products of 83 bp + 16 bp (allele
1) and 99 bp (allele 2).
The region that contains the AvaI polymorphic site at the position
511 of the IL-1beta gene was amplified by PCR [8]. The oligonucleotides
5'TGGCATTGATCTGGTTCATC3' and 5'GTTTAGGAATCTTCCCACTT3' flanking this region
were used as primers. PCR conditions were as follows: 95° C for 2
min, 55° C for 1 min, 74° C for 1 min, then 38 cycles of 95°
C for 1 min, 55° C for 1 min, 74° C for 1 min and finally 74°
C for 4 min. The products were digested with AvaI. Fragments were analysed
by electrophoresis on 9% PAGE, stained with ethidium bromide. This gave
products of 190 bp + 114 bp (allele 1) and 304 bp (allele 2).
Statistical analysis
The significance of allele associations was assessed with chi-square
test. ANOVA with post-hoc comparisons (LSD test of means) were used to
compare concentrations of plasma IL-1beta between individuals with different
IL-1alpha, IL-1beta and IL-1 receptor antagonist genotypes. As the IL-1beta
concentrations were not normally distributed, the values were square-root
transformed before statistical analysis. Statistical significance was
considered to be at the 0.05 level. Crude values are presented for clarity.
Statistical calculations were carried out using Statistica (ver. Win 5.1D,
StatSoft Inc., Tulsa, OK, USA).
RESULTS
DNA from blood samples from 400 blood donors was purified and their
genotype of the IL-1 complex was analysed. The data shown in Table
1. demonstrate that the allele frequencies of IL-1alpha (C to T exchange
at 889), IL-1beta (C to T exchange at 511) and IL-1Ra (pentaallelic
VNTR in the second intron) correspond to those originally published [2,
8, 10]. As expected these alleles are significantly associated (Table
2). It has recently been calculated that of the indicator polymorphisms
used here, IL-1alpha allele 1, IL-1beta allele 2 and IL-1Ra allele 2 belong
to the most frequent IL-1 gene cluster haplotype [16]. The data shown
in Table 2 are in accordance
with these data.
IL-1beta concentrations of the plasma samples derived from these same
400 blood donors were analysed using an ELISA method. In 392/400 samples
the concentrations were above the detection limit of the assay. Median
concentration was 5.78 pg/ml (2.2-13.6). When the IL-1beta levels were
categorised on the basis of IL-1alpha, IL-1beta and IL-1Ra genotypes,
the IL-1alpha genotype had a strong effect on IL-1beta plasma levels (Table
3). The IL-1alpha 2.2 homozygous donors had significantly higher IL-1beta
levels than 1.2 heterozygous or 1.1 homozygous donors (post-hoc comparisons).
The IL-1beta or IL-1Ra genotypes did not have any statistical significance,
independent effect on the plasma IL-1beta levels. To examine possible
effect of allele combinations, a two-way ANOVA analysis was performed.
Although not significant by definition, this analysis showed a trend that
the IL-1alpha genotype and IL-1beta allele 2 carrier state have an interactive
effect on IL-1beta plasma levels (p = 0.0615). Accordingly, we decided
to carry out post-hoc comparisons and this complementary interaction was
shown to be the consequence of distinctive IL-1beta production in IL-1alpha
2.2 homozygote/ IL-1beta allele 2 positive subjects (Figure
1). No interaction was seen when combined effects of IL-1alpha genotype
and IL-1Ra alleles or IL-1beta genotype and IL-1Ra alleles were studied
(two-way ANOVA, p = 0.9312 and p = 0.3723, respectively).
DISCUSSION
The data shown in this report demonstrate that the baseline plasma levels
of IL-1beta are genetically regulated, but this genetic effect could be
observed only in a small minority of blood donors, i.e. the plasma
levels were increased in those persons who were homozygous for the allele
2 of the IL-1alpha gene. Moreover, this effect of the IL-1alpha allele
2 homozygosity was influenced by the presence of the IL-1beta (
511) allele 2, thus suggesting either that the products of the various
loci of the IL-1 gene cluster interact in the regulation of the production
of the effector molecules or, alternatively, that the putative rare haplotype
in question contains an unidentified locus which allows a spontaneous
high production of IL-1beta.
The presence of allele 2 of the IL-1alpha 889 and allele 2 of
IL-1beta + 3,953 in the same haplotype in the IL-1 gene cluster has been
demonstrated recently [16]. As it was theoretically possible that the
high IL-1beta levels in IL-1alpha 2.2 homozygous subjects reported here
were caused by genetic linkage of IL-1alpha 889 and IL-1beta +
3,953 alleles, we have also analysed the + 3,953 polymorphism of IL-1beta
gene from this same population (results partly published in ref. 14).
The combination of IL-1alpha 889 allele 2 homozygosity with IL-1beta
+ 3,953 allele 2 carrier state was found in 26 subjects out of 400 analysed.
However, in our hands the IL-1beta + 3,953 polymorphism was not associated
with IL-1beta plasma levels (p = 0.612 in one-way ANOVA) and was omitted
for further analyses.
There is increasing evidence that the regulatory role of cytokine polymorphisms
could vary depending on the tissue, cell type or stimulus used [9, 17].
Furthermore, Perrier et al. [17] have demonstrated that in Sjögren's
syndrome the IL1RN*2 allele is associated with high serum levels of IL-1Ra,
but paradoxically with low IL-1Ra levels in saliva. Whether similar differences
exist in the regulation of local and circulating IL-1beta production is
an interesting question for further studies.
It should be noticed that the present analysis was performed using samples
from healthy individuals, i.e. without any infectious disease during
the last two weeks prior to the blood donation. It is known that the elevated
IL-1Ra levels in diabetic patients and baseline levels of healthy people
are regulated genetically in a similar way [13, 14]. In the case of IL-1beta
there is not much data about the genetic regulation of the induced in
vivo levels. Engebretson et al. [18] recently demonstrated
that gingival tissue IL-1beta levels were somewhat higher in individuals
carrying an IL-1 genotype, which also contains the IL-1alpha allele 2
(and probably also IL-1beta 511 allele 2, see ref. 16), thus maybe
speaking for a similar regulation of the induced and baseline levels.
There is not much many data about the clinical
significance of the base exchange polymorphism at the position
889 of the IL-1alpha gene. McDowell et al. observed that the number
of carriers of allele 2 was increased in patients with early-onset, pauciarticular
juvenile rheumatoid arthritis [10]. We have recently demonstrated that
the number of IL-1alpha 2.2 homozygotes (but not the total allele 2 frequency)
is significantly increased in schizophrenic patients and that the IL-1beta
plasma levels are elevated in acute, nontreated patients [19, 20]. Thus,
the present findings are perfectly in line with these earlier observations
and provide a plausible explanation for the increased levels of IL-1beta
in schizophrenic patients. However, the pathogenetic role of these genetically
determined IL-1beta levels remains to be established.
There is increasing data that the combinations of the IL-1beta and IL-1Ra
alleles are of clinical significance (and as the alleles of these loci
are associated to the IL-1alpha alleles, the observed effects may also
be influenced by the IL-1alpha allelism). For example, in inflammatory
bowel diseases the association between the IL-1beta and IL-1Ra alleles
is different from that in healthy individuals [21, 22]. The mechanisms
of these interactions and their effect e.g. on the quantity of
the cytokine produced are still poorly characterised. We have previously
published that the plasma levels of IL-1Ra in healthy subjects (n = 200)
were higher in IL-1Ra allele 2 carriers than in the non-carriers, but
this effect was restricted only to individuals who were also carriers
of the IL-1beta allele 2 (T at the position 511) [14]. These 200
subjects are included in the series of 400 used in current study and IL-1Ra
levels were therefore studied retrospectively in respect of IL-1alpha
889 polymorphism. However, IL-1alpha 889 polymorphism did
not change these regulatory IL-1Ra associations further. Moreover, no
correlation between the plasma IL-1beta and IL-1Ra levels was found (unpublished
observations). As IL-1beta allele 2 also had an influence on the IL-1alpha
allele 2.2 homozygosity-associated effect described in this report, it
could be speculated that this allele contains or codes for a regulative
element enhancing the transcription of itself and the adjacent genes.
The effect of the IL-1alpha alleles on the production of IL-1alpha itself
is not known (the plasma levels of IL-1alpha are below the detection level
of the immunoassays) but if it is assumed that 2.2 homozygosity is associated
with a high IL-1alpha transcription, these high levels would then effectively
induce IL-1beta production only in the presence of the "permissive" IL-1beta
allele 2.
CONCLUSION Acknowledgements.
This work was supported by a grant from The Medical Research Fund of Tampere
University Hospital. The authors would like to thank Mervi Salomäki,
Sinikka Repo-Koskinen and Katja Heinola for expert technical assistance.
REFERENCES
1. Dinarello C A. 1996. Biologic basis for interleukin-1 in disease.
Blood 87: 2095.
2. Tarlow J K, Blakemore A I, Lennard A, Solari R, Hughes H N, Steinkasserer
A, Duff G W. 1993. Polymorphism in human IL-1 receptor antagonist gene
intron 2 is caused by variable numbers of an 86-bp tandem repeat. Hum.
Genet. 91: 403.
3. Mansfield J C, Holden H, Tarlow J K, Di Giovine F S, McDowell T L,
Wilson A G, Holdsworth C D, Duff G W. 1994. Novel genetic association
between ulcerative colitis and the anti- inflammatory cytokine interleukin-1
receptor antagonist. Gastroenterology 106: 637.
4. Crusius J B, Pena A S, van Oosten B W, Bioque G, Garcia A, Dijkstra
C D, Polman C H. 1995. Interleukin-1 receptor antagonist gene polymorphism
and multiple sclerosis. Lancet 346: 979.
5. Tarlow J K, Clay F E, Cork M J, Blakemore A I, McDonagh A J, Messenger
A G, Duff G W. 1994. Severity of alopecia areata is associated with a
polymorphism in the interleukin-1 receptor antagonist gene. J. Invest.
Dermatol. 103: 387.
6. Blakemore A I, Cox A, Gonzalez A M, Maskil J K, Hughes M E, Wilson
R M, Ward J D, Duff G W. 1996. Interleukin-1 receptor antagonist allele
(IL-1RN*2) associated with nephropathy in diabetes mellitus. Hum. Genet.
97: 369.
7. Blakemore A I, Watson P F, Weetman A P, Duff G W. 1995. Association
of Graves' disease with an allele of the interleukin-1 receptor antagonist
gene. J. Clin. Endocrinol. Metab. 80: 111.
8. di Giovine F S, Takhsh E, Blakemore A I, Duff G W. 1992. Single base
polymorphism at -511 in the human interleukin-1beta gene. Hum. Mol.
Genet. 1: 450.
9. Pociot F, Molvig J, Wogensen L, Worsaae H, Nerup J. 1992. A TaqI
polymorphism in the human interleukin-1beta (IL-1beta) gene correlates
with IL-1 beta secretion in vitro. Eur. J. Clin. Invest.
22: 396.
10. McDowell T L, Symons J A, Ploski R, Forre O, Duff G W. 1995. A genetic
association between juvenile rheumatoid arthritis and a novel interleukin-1alpha
polymorphism. Arthritis Rheum. 38: 221.
11. Bailly S, di Giovine F S, Duff G W. 1993. Polymorphic tandem repeat
region in interleukin-1alpha intron 6. Hum. Genet. 91: 85.
12. Hack C E, Aarden L A, Thijs L G. 1997. Role of cytokines in sepsis.
Adv. Immunol. 66: 101.
13. Mandrup-Poulsen T, Pociot F, Molvig J, Shapiro L, Nilsson P, Emdal
T, Roder M, Kjems L L, Dinarello C A, Nerup J. 1994. Monokine antagonism
is reduced in patients with IDDM. Diabetes 43: 1242.
14. Hurme M, Santtila S. 1998. IL-1 receptor antagonist (IL-1Ra) plasma
levels are co-ordinately regulated by both IL-1Ra and IL-1beta genes.
Eur. J. Immunol. 28: 2598.
15. Miller S A, Dykes D D, Polesky H F. 1988. A simple salting out procedure
for extracting DNA from human nucleated cells. Nucleic Acids Res.
16: 1215.
16. Cox A, Camp N J, Nicklin M J, di Giovine F S, Duff G W. 1998. An
analysis of linkage disequilibrium in the interleukin-1 gene cluster,
using a novel grouping method for multiallelic markers. Am. J. Hum.
Genet. 62: 1180.
17. Perrier S, Coussediere C, Dubost J J, Albuisson E, Sauvezie B. 1998.
IL-1 receptor antagonist (IL-1Ra) gene polymorphism in Sjogren's syndrome
and rheumatoid arthritis. Clin. Immunol. Immunopathol. 87: 309.
18. Engebretson S P, Lamster I B, Herrera-Abreu M, Celenti R S, Timms
J M, Chaudhary A G, di Giovine F S, Kornman K S. 1999. The influence of
interleukin gene polymorphism on expression of interleukin-1-beta and
tumor necrosis factor-alpha in periodontal tissue and gingival crevicular
fluid. J. Periodontol. 70: 567.
19. Katila H, Hanninen K, Hurme M. 1999. Polymorphisms of the interleukin-1
gene complex in schizophrenia. Mol. Psychiatry 4: 179.
20. Katila H, Appelberg B, Hurme M, Rimon R. 1994. Plasma levels of
interleukin-1beta and interleukin-6 in schizophrenia, other psychoses,
and affective disorders. Schizophr. Res. 12: 29.
21. Bioque G, Crusius J B, Koutroubakis I, Bouma G, Kostense P J, Meuwissen
S G, Pena A S. 1995. Allelic polymorphism in IL-1beta and IL-1 receptor
antagonist (IL-1Ra) genes in inflammatory bowel disease. Clin. Exp.
Immunol. 102: 379.
22. Heresbach D, Alizadeh M, Dabadie A, Le Berre N, Colombel J F, Yaouanq
J, Bretagne JF, Semana G. 1997. Significance of interleukin-1beta and
interleukin-1 receptor antagonist genetic polymorphism in inflammatory
bowel diseases. Am. J. Gastroenterol. 92: 1164.
|
Printable version
