Home > Journals > Biology and research > European Cytokine Network > Full text
 
      Advanced search    Shopping cart    French version 
 
Latest books
Catalogue/Search
Collections
All journals
Medicine
Biology and research
European Cytokine Network
- Current issue
- Archives
- Subscribe
- Order an issue
- More information
Public health
Agronomy and biotech.
My account
Forgotten password?
Online account   activation
Subscribe
Licences IP
- Instructions for use
- Estimate request form
- Licence agreement
Order an issue
Pay-per-view articles
Newsletters
How can I publish?
Journals
Books
Help for advertisers
Foreign rights
Book sales agents



 

Texte intégral de l'article
 
  Printable version

A rare allele combination of the interleukin-1 gene complex is associated with high interleukin-1b plasma levels in healthy individuals.


European Cytokine Network. Volume 11, Number 2, 251-5, June 2000, Articles originaux


Summary  

Author(s) : J. Hulkkonen, P. Laippala, M. Hurne, M.D., Department of Microbiology and Immunology, University of Tampere Medical School, POB 607, FIN-33101, Tampere, Finland..

Summary : Increases in the plasma levels of the inflammatory cytokines can be detected in various infectious and inflammatory diseases, but in healthy individuals these levels are in most cases low or undetectable. There is now increasing evidence that genes of the inflammatory cytokines are polymorphic and the various alleles may differ in their capability to produce the cytokine. We have measured the plasma levels IL-1b of 400 healthy blood donors and correlated these to the genotype (biallelelic base exchanges at the position – 889 of the IL-1a gene, and at the position – 511 of the IL-1b gene and the pentaallelic VNTR in the second intron of the IL-1Ra gene). The median concentration of IL-1b was 5.8 pg/ml (upper and lower quartiles 2.2-13.6). The polymorphisms of the IL-1b and IL-1 Ra genes did not have any significant influence on the IL-1b levels, but the IL-1a 2.2 homozygotes (32/400 blood donors) had significantly elevated levels (median 7.0 pg/ml, quartiles 2.2-22.4, one-way ANOVA p < 0.008 as compared to the IL-1a 1.1 homozygotes and p < 0.02 as compared to the IL-1a 1.2 heterozygotes). This effect of IL-1a 2.2 homozygosity was more pronounced in donors, who also were carriers of the IL-1b allele 2. Thus these data suggest that this allele combination has a regulatory effect on basal IL-1b production.

Keywords : IL-1, gene, polymorphism, allele, plasma.

Pictures

ARTICLE

INTRODUCTION

The inflammatory reaction in infectious and autoimmune diseases is regulated by a delicate balance between the pro-inflammatory and anti-inflammatory cytokines. The IL-1 gene complex contains the genes for IL-1alpha, IL-1beta and IL-1Ra, of which the first two are strong inducers of inflammation, while IL-1Ra binds to the IL-1 receptors with high affinity without activating the cell, thus being an effective antagonist (for a review, see ref. 1).

The genes of the IL-1 complex are polymorphic. In the intron 2 of the IL-1Ra gene there are variable numbers of a tandem (86-bp) repeat sequence (VNTR), the most common allele (allele 1) (allele frequency 0.74) containing 4 repeats. Allele 2 contains 2 repeats and its frequency is 0.21 [2]. In several diseases, such as ulcerative colitis, multiple sclerosis, alopecia areata, diabetic nephropathy and Graves' disease the frequency of allele 2 is increased [3-7]. In the IL-1beta gene there are at least two biallelic base exchange polymorphisms: at the position ­ 511 in the promoter region and at the position + 3, 953 in the 5th exon [8, 9]. In the IL-1alpha gene there is a base exchange at the position ­ 889 and a VNTR polymorphism in intron 6 [10, 11]. The frequency of the more rare allele (allele 2, T at the position ­ 889) is increased in juvenile rheumatoid arthritis [10].

Regardless of the increasing amounts of data demonstrating the clinical significance of these polymorphisms the biological background of the differences in the mechanisms of action of these various alleles is still largely unknown. There are data showing that certain alleles may increase the production of a given cytokine when peripheral blood mononuclear cells are activated in vitro, but as the regulatory network does not probably function in the in vitro artificial conditions, the value of this information is limited. Measurements of inflammatory cytokine levels in blood have revealed their role e.g. in the regulation of septic infections (reviewed in ref. 12). How the genetic polymorphisms regulate the actual in vivo cytokine levels is known only in few cases, e.g. Mandrup-Poulsen et al. demonstrated that elevated levels of IL-1Ra could be detected in diabetic patients who were carriers of the IL-1Ra allele 2 (ILRN*2) [13]. By testing a higher number of people we recently demonstrated that this effect of the IL-1Ra allele 2 holds true also in normal healthy individuals, but we observed that this allele could function only if the allele 2 of IL-1beta (the rarer allele, T at the position ­ 511) was simultaneously present [14]. To further analyse the effect of gene polymorphisms in the regulation of the in vivo levels, we examined the role of alleles of the IL-1 gene complex on IL-1beta plasma levels.

METHODS

Blood donors

Blood samples were obtained from The Finnish Red Cross Blood Transfusion Centre, Tampere. The donors were adults (18-60 years old) and they had not had any sign of infection during a 2-week period before the blood donation. Plasma was separated within two hours after the blood donation and kept frozen until tested.

IL-1beta assay

Plasma IL-1beta levels were measured (in randomized samples) by using an IL-1beta ELISA-kit (Pelikine, CLB, Amsterdam, The Netherlands). This was performed according to the manufacturer's instructions. The detection limit of the assay was 0.4 pg/ml. The inter- and intra-assay coefficient of variations were 4.2 and 6.8%, respectively.

Analysis of IL-1Ra, IL-1a and IL-1b gene polymorphisms

Genomic DNA was isolated from the blood samples by using the salting out method [15].

The IL-1Ra exon 2 polymorphism was analysed as described [2]. Briefly, oligonucleotides 5'CTCAGCAACACTCCTAT3' and 5'TCCTGGTCTGCAGGTAA3' were used as primers in PCR. Conditions used were: denaturing step of 96° C for 1 min followed by 35 cycles of 94° C for 1 min, 60° C for 1 min, 70° C for 1 min and finally 72° C for 5 min. The PCR products were analysed by electrophoresis on a 2% agarose gel stained with ethidium bromide. Allele 1 (4 repeats) was 410 bp, allele 2 (2 repeats) 240 bp, allele 3 (3 repeats) 325 bp and allele 4 (5 repeats) 500 bp and allele 5 (6 repeats) 595 bp.

The base exchange at the position ­ 889 of the IL-1alpha gene was analysed as previously described [10]. Oligonucleotides 5'-AAGCTTGTT CTACCACCTGAACTAGGC-3' and 5'-TTACATATGAGC CTTCCATG-3' flanking the polymorphic site were used as primers in PCR. Conditions used were: a denaturing step of 96° C for 1 min and then 40 cycles of 94° C for 1 min, 51° C for 1 min, 72° C for 1 min and finally 72° C for 4 min and 55° C for 5 min. The products were digested with NcoI and the resultant products were analysed on 9% PAGE. This gave products of 83 bp + 16 bp (allele 1) and 99 bp (allele 2).

The region that contains the AvaI polymorphic site at the position ­ 511 of the IL-1beta gene was amplified by PCR [8]. The oligonucleotides 5'TGGCATTGATCTGGTTCATC3' and 5'GTTTAGGAATCTTCCCACTT3' flanking this region were used as primers. PCR conditions were as follows: 95° C for 2 min, 55° C for 1 min, 74° C for 1 min, then 38 cycles of 95° C for 1 min, 55° C for 1 min, 74° C for 1 min and finally 74° C for 4 min. The products were digested with AvaI. Fragments were analysed by electrophoresis on 9% PAGE, stained with ethidium bromide. This gave products of 190 bp + 114 bp (allele 1) and 304 bp (allele 2).

Statistical analysis

The significance of allele associations was assessed with chi-square test. ANOVA with post-hoc comparisons (LSD test of means) were used to compare concentrations of plasma IL-1beta between individuals with different IL-1alpha, IL-1beta and IL-1 receptor antagonist genotypes. As the IL-1beta concentrations were not normally distributed, the values were square-root transformed before statistical analysis. Statistical significance was considered to be at the 0.05 level. Crude values are presented for clarity. Statistical calculations were carried out using Statistica (ver. Win 5.1D, StatSoft Inc., Tulsa, OK, USA).

RESULTS

DNA from blood samples from 400 blood donors was purified and their genotype of the IL-1 complex was analysed. The data shown in Table 1. demonstrate that the allele frequencies of IL-1alpha (C to T exchange at ­ 889), IL-1beta (C to T exchange at ­ 511) and IL-1Ra (pentaallelic VNTR in the second intron) correspond to those originally published [2, 8, 10]. As expected these alleles are significantly associated (Table 2). It has recently been calculated that of the indicator polymorphisms used here, IL-1alpha allele 1, IL-1beta allele 2 and IL-1Ra allele 2 belong to the most frequent IL-1 gene cluster haplotype [16]. The data shown in Table 2 are in accordance with these data.

IL-1beta concentrations of the plasma samples derived from these same 400 blood donors were analysed using an ELISA method. In 392/400 samples the concentrations were above the detection limit of the assay. Median concentration was 5.78 pg/ml (2.2-13.6). When the IL-1beta levels were categorised on the basis of IL-1alpha, IL-1beta and IL-1Ra genotypes, the IL-1alpha genotype had a strong effect on IL-1beta plasma levels (Table 3). The IL-1alpha 2.2 homozygous donors had significantly higher IL-1beta levels than 1.2 heterozygous or 1.1 homozygous donors (post-hoc comparisons). The IL-1beta or IL-1Ra genotypes did not have any statistical significance, independent effect on the plasma IL-1beta levels. To examine possible effect of allele combinations, a two-way ANOVA analysis was performed. Although not significant by definition, this analysis showed a trend that the IL-1alpha genotype and IL-1beta allele 2 carrier state have an interactive effect on IL-1beta plasma levels (p = 0.0615). Accordingly, we decided to carry out post-hoc comparisons and this complementary interaction was shown to be the consequence of distinctive IL-1beta production in IL-1alpha 2.2 homozygote/ IL-1beta allele 2 positive subjects (Figure 1). No interaction was seen when combined effects of IL-1alpha genotype and IL-1Ra alleles or IL-1beta genotype and IL-1Ra alleles were studied (two-way ANOVA, p = 0.9312 and p = 0.3723, respectively).

DISCUSSION

The data shown in this report demonstrate that the baseline plasma levels of IL-1beta are genetically regulated, but this genetic effect could be observed only in a small minority of blood donors, i.e. the plasma levels were increased in those persons who were homozygous for the allele 2 of the IL-1alpha gene. Moreover, this effect of the IL-1alpha allele 2 homozygosity was influenced by the presence of the IL-1beta (­ 511) allele 2, thus suggesting either that the products of the various loci of the IL-1 gene cluster interact in the regulation of the production of the effector molecules or, alternatively, that the putative rare haplotype in question contains an unidentified locus which allows a spontaneous high production of IL-1beta.

The presence of allele 2 of the IL-1alpha ­ 889 and allele 2 of IL-1beta + 3,953 in the same haplotype in the IL-1 gene cluster has been demonstrated recently [16]. As it was theoretically possible that the high IL-1beta levels in IL-1alpha 2.2 homozygous subjects reported here were caused by genetic linkage of IL-1alpha ­ 889 and IL-1beta + 3,953 alleles, we have also analysed the + 3,953 polymorphism of IL-1beta gene from this same population (results partly published in ref. 14). The combination of IL-1alpha ­ 889 allele 2 homozygosity with IL-1beta + 3,953 allele 2 carrier state was found in 26 subjects out of 400 analysed. However, in our hands the IL-1beta + 3,953 polymorphism was not associated with IL-1beta plasma levels (p = 0.612 in one-way ANOVA) and was omitted for further analyses.

There is increasing evidence that the regulatory role of cytokine polymorphisms could vary depending on the tissue, cell type or stimulus used [9, 17]. Furthermore, Perrier et al. [17] have demonstrated that in Sjögren's syndrome the IL1RN*2 allele is associated with high serum levels of IL-1Ra, but paradoxically with low IL-1Ra levels in saliva. Whether similar differences exist in the regulation of local and circulating IL-1beta production is an interesting question for further studies.

It should be noticed that the present analysis was performed using samples from healthy individuals, i.e. without any infectious disease during the last two weeks prior to the blood donation. It is known that the elevated IL-1Ra levels in diabetic patients and baseline levels of healthy people are regulated genetically in a similar way [13, 14]. In the case of IL-1beta there is not much data about the genetic regulation of the induced in vivo levels. Engebretson et al. [18] recently demonstrated that gingival tissue IL-1beta levels were somewhat higher in individuals carrying an IL-1 genotype, which also contains the IL-1alpha allele 2 (and probably also IL-1beta ­ 511 allele 2, see ref. 16), thus maybe speaking for a similar regulation of the induced and baseline levels.

There is not much many data about the clinical significance of the base exchange polymorphism at the position ­ 889 of the IL-1alpha gene. McDowell et al. observed that the number of carriers of allele 2 was increased in patients with early-onset, pauciarticular juvenile rheumatoid arthritis [10]. We have recently demonstrated that the number of IL-1alpha 2.2 homozygotes (but not the total allele 2 frequency) is significantly increased in schizophrenic patients and that the IL-1beta plasma levels are elevated in acute, nontreated patients [19, 20]. Thus, the present findings are perfectly in line with these earlier observations and provide a plausible explanation for the increased levels of IL-1beta in schizophrenic patients. However, the pathogenetic role of these genetically determined IL-1beta levels remains to be established.

There is increasing data that the combinations of the IL-1beta and IL-1Ra alleles are of clinical significance (and as the alleles of these loci are associated to the IL-1alpha alleles, the observed effects may also be influenced by the IL-1alpha allelism). For example, in inflammatory bowel diseases the association between the IL-1beta and IL-1Ra alleles is different from that in healthy individuals [21, 22]. The mechanisms of these interactions and their effect e.g. on the quantity of the cytokine produced are still poorly characterised. We have previously published that the plasma levels of IL-1Ra in healthy subjects (n = 200) were higher in IL-1Ra allele 2 carriers than in the non-carriers, but this effect was restricted only to individuals who were also carriers of the IL-1beta allele 2 (T at the position ­ 511) [14]. These 200 subjects are included in the series of 400 used in current study and IL-1Ra levels were therefore studied retrospectively in respect of IL-1alpha ­ 889 polymorphism. However, IL-1alpha ­ 889 polymorphism did not change these regulatory IL-1Ra associations further. Moreover, no correlation between the plasma IL-1beta and IL-1Ra levels was found (unpublished observations). As IL-1beta allele 2 also had an influence on the IL-1alpha allele 2.2 homozygosity-associated effect described in this report, it could be speculated that this allele contains or codes for a regulative element enhancing the transcription of itself and the adjacent genes. The effect of the IL-1alpha alleles on the production of IL-1alpha itself is not known (the plasma levels of IL-1alpha are below the detection level of the immunoassays) but if it is assumed that 2.2 homozygosity is associated with a high IL-1alpha transcription, these high levels would then effectively induce IL-1beta production only in the presence of the "permissive" IL-1beta allele 2.

CONCLUSION

Acknowledgements. This work was supported by a grant from The Medical Research Fund of Tampere University Hospital. The authors would like to thank Mervi Salomäki, Sinikka Repo-Koskinen and Katja Heinola for expert technical assistance.

REFERENCES

1. Dinarello C A. 1996. Biologic basis for interleukin-1 in disease. Blood 87: 2095.

2. Tarlow J K, Blakemore A I, Lennard A, Solari R, Hughes H N, Steinkasserer A, Duff G W. 1993. Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat. Hum. Genet. 91: 403.

3. Mansfield J C, Holden H, Tarlow J K, Di Giovine F S, McDowell T L, Wilson A G, Holdsworth C D, Duff G W. 1994. Novel genetic association between ulcerative colitis and the anti- inflammatory cytokine interleukin-1 receptor antagonist. Gastroenterology 106: 637.

4. Crusius J B, Pena A S, van Oosten B W, Bioque G, Garcia A, Dijkstra C D, Polman C H. 1995. Interleukin-1 receptor antagonist gene polymorphism and multiple sclerosis. Lancet 346: 979.

5. Tarlow J K, Clay F E, Cork M J, Blakemore A I, McDonagh A J, Messenger A G, Duff G W. 1994. Severity of alopecia areata is associated with a polymorphism in the interleukin-1 receptor antagonist gene. J. Invest. Dermatol. 103: 387.

6. Blakemore A I, Cox A, Gonzalez A M, Maskil J K, Hughes M E, Wilson R M, Ward J D, Duff G W. 1996. Interleukin-1 receptor antagonist allele (IL-1RN*2) associated with nephropathy in diabetes mellitus. Hum. Genet. 97: 369.

7. Blakemore A I, Watson P F, Weetman A P, Duff G W. 1995. Association of Graves' disease with an allele of the interleukin-1 receptor antagonist gene. J. Clin. Endocrinol. Metab. 80: 111.

8. di Giovine F S, Takhsh E, Blakemore A I, Duff G W. 1992. Single base polymorphism at -511 in the human interleukin-1beta gene. Hum. Mol. Genet. 1: 450.

9. Pociot F, Molvig J, Wogensen L, Worsaae H, Nerup J. 1992. A TaqI polymorphism in the human interleukin-1beta (IL-1beta) gene correlates with IL-1 beta secretion in vitro. Eur. J. Clin. Invest. 22: 396.

10. McDowell T L, Symons J A, Ploski R, Forre O, Duff G W. 1995. A genetic association between juvenile rheumatoid arthritis and a novel interleukin-1alpha polymorphism. Arthritis Rheum. 38: 221.

11. Bailly S, di Giovine F S, Duff G W. 1993. Polymorphic tandem repeat region in interleukin-1alpha intron 6. Hum. Genet. 91: 85.

12. Hack C E, Aarden L A, Thijs L G. 1997. Role of cytokines in sepsis. Adv. Immunol. 66: 101.

13. Mandrup-Poulsen T, Pociot F, Molvig J, Shapiro L, Nilsson P, Emdal T, Roder M, Kjems L L, Dinarello C A, Nerup J. 1994. Monokine antagonism is reduced in patients with IDDM. Diabetes 43: 1242.

14. Hurme M, Santtila S. 1998. IL-1 receptor antagonist (IL-1Ra) plasma levels are co-ordinately regulated by both IL-1Ra and IL-1beta genes. Eur. J. Immunol. 28: 2598.

15. Miller S A, Dykes D D, Polesky H F. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16: 1215.

16. Cox A, Camp N J, Nicklin M J, di Giovine F S, Duff G W. 1998. An analysis of linkage disequilibrium in the interleukin-1 gene cluster, using a novel grouping method for multiallelic markers. Am. J. Hum. Genet. 62: 1180.

17. Perrier S, Coussediere C, Dubost J J, Albuisson E, Sauvezie B. 1998. IL-1 receptor antagonist (IL-1Ra) gene polymorphism in Sjogren's syndrome and rheumatoid arthritis. Clin. Immunol. Immunopathol. 87: 309.

18. Engebretson S P, Lamster I B, Herrera-Abreu M, Celenti R S, Timms J M, Chaudhary A G, di Giovine F S, Kornman K S. 1999. The influence of interleukin gene polymorphism on expression of interleukin-1-beta and tumor necrosis factor-alpha in periodontal tissue and gingival crevicular fluid. J. Periodontol. 70: 567.

19. Katila H, Hanninen K, Hurme M. 1999. Polymorphisms of the interleukin-1 gene complex in schizophrenia. Mol. Psychiatry 4: 179.

20. Katila H, Appelberg B, Hurme M, Rimon R. 1994. Plasma levels of interleukin-1beta and interleukin-6 in schizophrenia, other psychoses, and affective disorders. Schizophr. Res. 12: 29.

21. Bioque G, Crusius J B, Koutroubakis I, Bouma G, Kostense P J, Meuwissen S G, Pena A S. 1995. Allelic polymorphism in IL-1beta and IL-1 receptor antagonist (IL-1Ra) genes in inflammatory bowel disease. Clin. Exp. Immunol. 102: 379.

22. Heresbach D, Alizadeh M, Dabadie A, Le Berre N, Colombel J F, Yaouanq J, Bretagne JF, Semana G. 1997. Significance of interleukin-1beta and interleukin-1 receptor antagonist genetic polymorphism in inflammatory bowel diseases. Am. J. Gastroenterol. 92: 1164.


 

About us - Contact us - Conditions of use - Secure payment
Latest news - Conferences
Copyright © 2007 John Libbey Eurotext - All rights reserved
[ Legal information - Powered by Dolomède ]