Induction of natural killer cell activity and perforin and granzyme B gene expression following continuous culture of short pulse with interleukin-12 in young and old mice.

ARTICLE

INTRODUCTION

Interleukin-12 (IL-12) is a key regulator of cell-mediated immunity that has therapeutic potential in cancer and infectious diseases [1, 2]. The major target cells of IL-12 action are natural killer (NK) and T cells, in which IL-12 induces production of cytokines, proliferation, enhancement of cytotoxic activity, and secretion of cytotoxic granules [3-7].

Data from the literature have reported that the efficacy of stimulation with IL-12 for cancer therapy is often limited by the occurrence of several toxic effects, and that protocols adapted to reduce toxicity also lower the therapeutic effect [8-11].

In recent years, several studies have proposed a new therapeutic approach based on the induction of antitumor cytotoxic cells through a short cytokine "pulse" [12-15]. This kind of immunotherapy, which was studied for IL-2, was also based on the fact that a brief pulse of lymphocytes with IL-2 was sufficient to develop cytotoxic cells having the same levels of cytolytic activity as those of cells cultured continuously in IL-2 [12-15]. The pulsing with IL-2 was also efficient in generating cytotoxic cells in elderly patients, i.e., in subjects in whom a low responsiveness to the in vitro stimulation with IL-2, and the risk of intolerance to high IL-2 dosage have been previously reported [15].

There are few studies concerning the effect of IL-12 on the induction of cytotoxic cells during aging. IL-12 was shown to enhance NK cytotoxicity to the same degree in both young and elderly subjects, whereas the induction of lymphokine activated killer (LAK) cell activity was decreased in elderly compared to young individuals [16]. Furthermore, IL-12 was able to enhance CTL responses in elderly subjects and aged mice [17, 18].

The aim of this paper was to investigate the effect of IL-12 on endogenous and IL-2-induced NK cell activity of spleen cells from old mice and the efficacy of in vitro pulsing with IL-12 of spleen lymphocytes from young and old mice, to evaluate the potential usefulness of the pulsing procedure in immunotherapy with cytokines. The cytotoxic activity and the mRNA for perforins and granzyme B were determined and compared with those obtained in non-pulsed spleen lymphocytes cultured continuously in IL-12.

METHODS

Animals

Male Balb/c inbred mice were housed in plastic cages and fed with food pellets and water ad libitum, and used as donors of spleen cells at 2 and 24 months of age.

Target cells

The target cells were the murine lymphoma cell line YAC-1, which is a very sensitive target for mouse NK activity. This tumour cell line was maintained in continous culture throughout the study in RPMI 1640 medium (Gibco), 10% decomplemented fetal calf serum (FCS), 100 mug/ml streptomicin, 100 U/ml penicillin (all from Gibco).

Isolation and culture of spleen lymphocytes

Spleen cells were obtained by pressing the spleen throught a sieve in Ca²⁺ and Mg²⁺-free phosphate-buffered saline (PBS, GIBCO, Gaithersburg, Md, USA). Spleen cells were then fractionated on lympholyte M (Cedarlane, Canada) and mononuclear cells separated by density gradient centrifugation (500 g, 20 min.). Cells from the interface of the gradients were washed twice with PBS and resuspended in RPMI 1640 containing penicillin (100 U/ml) and streptomycin (100 mug/ml) at a concentration of 3 x 10⁶/ml.

To evaluate IL-12 and/or IL-2-induced NK cell activity, spleen lymphocytes were incubated for 20 hours at 37° C in 5% CO₂, at a concentration of 3 x 10⁶/ml in RPMI 1640 + 10% FCS, with or without recombinant murine IL-12 (R&D System, Minneapolis, USA) at concentrations ranging from 0.25 to 10 ng/ml and/or recombinant human IL-2 (Proleukin, EuroCetus, The Netherlands) at concentrations of 100 or 1,000 UI/ml. In IL-12-pulsing experiments, for each individual mouse, 6 x 10⁶ spleen cells were incubated for 1 hour, unless otherwise indicated, with the addition of 1 ng/ml recombinant mouse IL-12 as the "pulse" dose, and were subsequently washed twice to remove the IL-12 from the medium. Prior experiments had shown that this procedure reduced the residual concentration of cytokine to almost undetectable levels. In additional experiments, in order to study the shortest pulsing time, the exposure to IL-12 ranged from 5 min to 1 hour. The cells were subsequently suspended in RPMI 1640 plus 10% FCS and cultured for 20 hours or 3 days. Control cultures consisted of non-pulsed mononuclear spleen cells cultured under the same conditions, in the presence or absence of 1 ng/ml IL-12. After culture, cells were washed and resuspended in RPMI 1640 + 10% FCS in order to determine cytotoxic activity and phenotype.

Phenotype of spleen cells and flow cytometry

The phycoerythrin (PE) or fluorescein isothiocyanate (FITC) conjugated monoclonal antibodies, anti-p75 IL-2 receptor beta-chain (CD122) or anti-p55 IL-2 receptor alpha-chain (CD25) were obtained from Pharmingen (San Diego, CA). Rabbit anti-Asialo GM1 (used at 1/40 dilution) was purchased from Wako Co (Dallas, Tex. USA). FITC-conjugated sheep anti-rabbit IgG (Serotec, Oxford, UK) was used as the second antibody.

Spleen cells (1 x 10⁶) were washed in PBS containing 0.1% NaN₃ plus 5% FCS and labelled with MoAb for 30 min on ice. At the end of the incubation, cells were washed in PBS containing 0.1% NaN₃ and resuspended in Isoton II (Coulter, Euro Diagnostic, GMBH) and immediately analysed with a Coulter XL flow cytometer.

Cytotoxic assay

Cytotoxic assay was performed using a fluorimetric method as recently reported [19]. Briefly, a stock solution of carboxyfluorescein diacetate (c'FDA, Molecular Probes, Oregon, USA) (20 mg/ml acetone, stored at ­ 20° C) was diluted in phosphate-buffered saline (PBS) to give a final concentration of 75 mug/ml. YAC-1 tumor cells were washed twice with PBS and then labelled with c'FDA by resuspending the cells in 1 ml of working solution and incubating at 37° in a humidified, 5% CO₂ incubator for 30 min. Target cells were then washed 3 times in PBS containing 1% BSA (Sigma, USA) and resuspended in RPMI + 10% FCS at a concentration of 1 x 10⁵/ml. 1 x 10⁴ c'FDA-labelled tumor target cells were incubated with effector cells in 200 mul total volume in 96-well round microtiter plates (Nunc, W.G.). Effector: target cell ratios from 100:1 to 12.5:1 were tested in triplicate. The plates were kept at 37° in a humidified, 5% CO₂ incubator for 3 hours and then centrifuged at 700 x g for 5 min. The supernatant was separated from the cellular fraction by rapidly inverting the plate and flicking the supernatants out. Then, 100 mul of 1% triton X100 in 0.05 M borate buffer, pH 9.0 was added to each well. The plate was kept for 20 hours at 4° C to allow for solubilization and then was read for fluorescence with a 1420 VICTOR² multilabel counter (Wallac, Turku, Finland). The percentage of specific lysis was calculated as follows:

% Specific lysis = [(Fmed ­ Fexp)/Fmed] x 100

where F represents the fluorescence of the solubilized cells after the supernatant has been removed; med = F from target incubated in medium alone; exp = F from target incubated with effector cells.

Lytic units (LU₂₀/10⁷ cells) were calculated by using a computational method [20]. One LU corresponded to the number of effector cells required to produce 20% specific lysis.

Isolation of RNA and RT-PCR

The expression of mRNA for perforin and granzyme B was evaluated in spleen lymphocytes from young and old mice by RT-PCR. RNA from 1 x 10⁶ spleen lymphocytes was extracted using Tri-reagent according to the manufacturer's instructions (Sigma Chemical Co., USA). RNA concentrations were determined using the spectrophotometer (Scientific instruments UV1601 Shimadzu, Columbia, MD, USA) and Ribogreen quantitation reagent, which is an ultrasensitive fluorescent nucleic acid stain for quantitating RNA in solution (Molecular Probes, Eugene, OR, USA).

cDNA was synthesised from 0.1 mug RNA using an Enhanced Avian RT-PCR Kit (Sigma) incubating RNA with dNTP (0.5 mM), RandomNonamers (2.5 muM), Buffer AMV-RT (1 X), Enhanced AvianRT (1 U/mul), RNase Inhibitor (1 U/mul) according to the manufacturer's instructions in a final volume of 20 mul. The cDNA was frozen at ­ 20° C until use.

PCR was performed using an Enhanced Avian RT-PCR Kit (Sigma) as follows: 3 mul of cDNA were added to a reaction mixture containing AccuTaq Buffer (1 X), dNTP (200 muM), specific upper and lower primers (400 muM of each), AccuTaq LA DNA polymerase (0.05 U/mul) in a total volume of 50 mul. The samples were incubated in a GeneAmp PCR System 9700 (Perkin Elmer) for a total of 35 cycles for perforin and granzyme B, and 25 cycles for beta-actin.

Each cycle consisted of: 1 min. at 94° C, 1 min. at a primer-specific annealing temperature (perforin and granzyme B, 60° C; beta-actin, 65° C), 2 min. at 72° C. The primers for perforin, granzyme B and beta-actin were purchased from Roche Diagnostics (GmbH, Germany) using published cDNA sequences. The perforin fragment of 486 bp were defined by the upper primer: GGTGGAGTGGAGGTTTTTGTACC and lower primer: CAGAATGCAAGCAGAAGCACAAG; granzyme B fragment 531 bp by the upper primer: CCTGAAGGAGGCTGTGAAAGAATC and lower primer: CCCTGCACAAATCATGTTTAGTCC and beta-
actin fragment 349 bp by the upper primer: TGGAATCCTGTGGCATCCATGAAAC and lower primer: TAAAACGCAGCTCAGTAACAGTCCG. The PCR products and a molecular weight standard (DNA molecular weight marker VIII, Roche Diagnostics) were visualised after electrophoresis in a 1.5% agarose gel containing 1.0 mug/ml ethidium bromide (EtBr). Densitometric analysis was perfomed using the OptiQuant Image Analysis Software (Packard Inst. Company, Inc.).

Statistical analysis

Statistical analysis was performed using parametric (Student's t-test) or non-parametric tests (Mann-Whitney Rank Sum test) on the basis of the distribution of the data. Differences between means were considered significant at P < 0.05. Data analysis was performed with SigmaStat software version 1.03 (Jandel Scientific, Germany).

RESULTS

Effect of IL-12 treatment on endogenous and IL2-induced NK cell activity in young and old mice

Spleen cells from young and old mice were placed in culture with IL-12 concentrations ranging from 0.25 to 10 ng/ml for 20 hours. As shown in Figure 1, all IL-12 concentrations tested were able to increase the endogenous levels of NK cell activity in both young (Figure 1A) and old (Figure 1B) mice. An IL-12 dose of 1 ng/ml was chosen as optimal for studying the effect of IL-12 alone or in combination with IL-2 on NK cytotoxicity in both groups of mice.

As shown in Table 1, the incubation with IL-12 increased endogenous NK activity in spleen cells from both young and old mice, with a lower increase in spleen cells from old animals. As observed for IL-12-induced NK cytotoxicity, the boosting of NK cells through IL-2 was lower in old mice than in young mice. The stimulation of NK cells with both cytokines determined higher increases of NK cytotoxic activity in comparison with IL-12 or IL-2 alone, in both groups of mice. These results were obtained using either optimal or suboptimal IL-2 concentrations. The boosting of NK activity was higher when IL-12 was used with a suboptimal IL-2 concentration (Table 1). The relative increases of IL-12 plus IL-2 versus optimal IL-2 were 1.53 and 4.26 in young and old mice respectively; similarly, 3.01 and 25.74-fold increases were obtained using suboptimal IL-2 in young and old mice respectively (Table 1).

Effect of IL-12 treatment on NK cell number and IL-2 receptor levels in young and old mice

Table 2 shows the effect of incubation of spleen cells from young and old mice with IL-12 for 20 hours, on the number of AsGM1⁺ (NK) cells and on the number of cells expressing p55 or p75 IL-2 receptors. The number of AsGM1⁺ cells was not significantly increased after in vitro IL-12 treatment in either young or old mice. The percentage of cells carrying p55 or p75 IL-2 receptors was increased in young mice but not in old animals.

Effect of IL-12 pulsing on NK cell cytotoxic activity in young and old mice

Spleen cells from young and old mice were pulsed with IL-12, washed, and incubated in the absence of IL-12 for 20 hours or 3 days. As shown in Table 3, the IL-12 pulsing of lymphocytes from 5 min to 1 hour generated amounts of cytotoxicity comparable to those obtained in IL-12-non-pulsed cultures. As shown in Table 4, significant levels of cytotoxic activity against YAC-1 target cells were observed in pulsed spleen cells from both young and old mice. The efficacy of IL-12 pulsing was also obtained in cultures supplemented with suboptimal IL-2 in which the levels of cytotoxic activity reached after 20 hours incubation were similar to those found in IL-12 plus IL-2, non-pulsed cultures. In order to evaluate the length of the effect of IL-12 pulsing on the development of NK cell activity, we incubated pulsed or non-pulsed spleen lymphocytes for one or three days before cytotoxic assay. Comparable values of cytotoxicity between IL-12 pulsed and non-pulsed cultures were obtained both on day one and on day three of incubation in both young and old mice. The effect of the IL-12-pulse was also observed in IL-2 supplemented cultures in which no significant differences were obtained between IL-12 pulsed and non-pulsed cultures (Table 4). The IL-12 pulsing induced a low but significant increase of p55 and p75 IL-2 receptors on young spleen lymphocytes (Table 2).

Effect of IL-12 pulsing on perforin and granzyme B mRNA expression in young and old mice

To evaluate whether the IL-12 pulsing was able to modulate the expression of mRNA for perforin and granzyme B, RT-PCR of total RNA extracted from IL-12-pulsed or non-pulsed cultures were performed. As shown in Figure 2, both perforin and granzyme B mRNA were increased after 20 hours incubation in the continous presence of IL-12, compared to control cultures. The IL-12 pulsing was effective in inducing both perforin and granzyme B as compared to the controls, as observed for IL-12-non-pulsed cultures.

DISCUSSION

Experimental and clinical studies have clearly demonstrated the therapeutic potential of IL-12 in neoplastic diseases [1, 2]. Although important antitumor responses have been achieved with IL-12 therapy, these have been associated with the occurrence of severe toxicity, particularly after repeated cytokine administration [8-11].

The use of cytokines in immunotherapy has not been applied, so far, in elderly people, mainly because of the suspected low responsiveness of "aged" lymphocytes to the in vitro cytokine-stimulation, or the risk of cytokine-induced toxicity [21].

We have recently demonstrated the possibility of generating highly cytotoxic cells, with IL-2, in elderly people, with levels of toxicity comparable to those obtained in younger people [22]. Furthermore, we and others have shown the efficacy of developing antitumor cytotoxic cells by a brief exposure of lymphocytes to high concentrations of IL-2, thus highlighting a possible new therapeutic strategy which might reduce treatment-related toxicity while preserving therapeutic benefit [12-15].

In this paper we have evaluated the effect of IL-12 on endogenous and IL-2-induced NK activity during aging, and the efficacy of in vitro pulsing with IL-12 of spleen lymphocytes from young and old mice, to establish the potential usefulness of this procedure in immunotherapy with cytokines in young and old subjects.

We report that : 1) IL-12 administration increases NK cell activity in both young and old mice, and 2) a brief exposure of spleen lymphocytes to IL-12 results in the induction of antitumor cells with cytotoxic activity and cytolytic granule production not significantly different from that of spleen lymphocytes cultured continuously with IL-12.

The effect of aging on the in vitro induction of antitumor cytotoxic cells through IL-12 has not been well studied until now. The few reports available have demonstrated that IL-12 can enhance NK cytotoxicity to the same degree in both young and elderly subjects [16], and that IL-12 can improve CTL responses in old individuals and aged mice [17, 18]. In agreement with these observations, our data confirm and extend the knowledge on the effectiveness of IL-12 in inducing antitumor lymphocytes in old as well as young mice. In particular, the relative increases in cytotoxicity obtained by the simultaneous administration of IL-12 and IL-2 in comparison with IL-2 alone, were higher in old than in young mice, even if the levels of cytotoxic activity obtained in old mice did not reach those found in younger animals. Similar findings were obtained studying the effect of IL-12 on the development of CTL activity [17].

As previously reported, the enhancement of NK cell activity modulated by IL-12 was possibly related to a potentiation of the cytolytic machinery of NK cells rather than to an increase of NK cell number, as demonstrated by the same number of AsGM1⁺ cells in IL-12-treated and untreated cells [23].

As we have recently demonstrated for IL-2 [15], the present finding of a good responsiveness of aged lymphocytes to IL-12 allow us to eliminate the potential low induction of cytotoxicity of lymphocytes with IL-12 from old individuals, indicating clearly that the main problem for immunotherapy in aging may be related to the toxicity of IL-12, which has been already reported in young-adult age groups and which is strongly suspected in older patients. For this reason, we have studied the efficacy of in vitro pulsing with IL-12 in the generation of antitumor, cytotoxic NK cells.

The efficacy of the in vitro pulsing procedure has been described in both cancer patients and in healthy donors. We recently reported that a brief exposure of peripheral lymphocytes from elderly cancer patients to IL-2 resulted in the generation of LAK cells with cytotoxic activity, phenotype, viability, and cell cycle phase not significantly different from those of lymphocytes cultured continuously with IL-2 [15].

The results reported in this paper demonstrate for the first time, the efficacy of in vitro pulsing with IL-12 in the induction of NK cell activity, suggesting the potential application of pulsing procedures in both young and old subjects.

Besides evaluating the efficacy of the pulsing procedure in terms of cytotoxic activity, we have studied the mRNA expression for perforin and granzyme B of IL-12-pulsed cells in comparison with non-pulsed cultures. Perforin (perforating protein) and associated granule proteases (granzymes) are cytolytic molecules located in the cytoplasmic granules responsible of the cytolytic machinery of NK cells [24]. Previous papers have demonstrated that IL-12 treatment induces the expression of mRNA for both perforin and granzyme B, with consequent augmentation of lytic activity [6, 17, 25]. The evidence reported in this paper, that both perforin and granzyme B mRNA are similarly increased in IL-12-pulsed or non-pulsed lymphocytes in comparison with IL-12-untreated cells, further supports the efficacy of the pulsing procedure in generating antitumor cytolytic cells.

The knowledge that a brief cytokine pulse may generate levels of cytotoxicity comparable to those obtained in cells cultured continuously with the cytokine may have relevant clinical applications, suggesting the possibility of reducing treatment-related toxicity without loss of therapeutic efficacy. With regards to IL-2, human and mouse studies have demonstrated the efficacy and feasibility of the pulsing procedure. In humans, effective antitumor immunity with very low toxicity was conferred by IL-2 pulsed cells [26]. In mice, it has been demonstrated that IL-12, administered in combination with an IL-2 pulse, induced rapid and complete regression of primary and metastatic renal carcinoma without appreciable toxicity; on the other hand, the combination of IL-12 and chronic IL-2 appeared to be extremely toxic [27]. Data from the literature have clearly demonstrated that chronic IL-12 administration is associated with serious, dose-dependent toxicity [8-11]. The possibility of applying pulsing with IL-12, alone or in combination with IL-2, may represent a new and appropriate immunotherapeutic approach for both young-adult and older subjects.

REFERENCES

1. Chougnet C, Shearer G M. 1996. Potential clinical applications of interleukin-12. (Review) Curr. Opin. Hematol. 3: 216.

2. Trinchieri G. 1998. Immunobiology of interleukin-12. (Review) Immunol. Res. 17: 269.

3. Gately M K, Desai B B, Wolitzki A G, Quinn P M, Dwyer C M, Podlasky F J, Familletti P C, Sinigaglia F, Chizzonite R, Gubler U, Stern A S. 1991. Regulation of human lymphocyte proliferation by a heterodimeric cytokine, IL-12 (cytotoxic lymphocyte maturation factor). J. Immunol. 147: 874.

4. Gately M K, Wolitzky A G, Quinn P M, Chizzonite R. 1992. Regulation of human cytolytic lymphocyte responses by IL-12. Cell. Immunol. 143: 127.

5. Mehrotra P T, Wu D, Crim J A, Mostowski H S, Siegel J P. 1993. Effects of IL-12 on the generation of cytotoxic activity in human CD8⁺ T lymphocytes. J. Immunol. 151: 2444.

6. DeBlaker-Hohe D F, Yamauchi A, Yu C R, Horvath-Arcidiacono J A, Bloom E T. 1995. IL-12 synergizes with IL-2 to induce lymphokine-activated cytotoxicity and perforin and granzyme gene expression in fresh human NK cells. Cell. Immunol. 165: 33.

7. Lamont A G, Adorini L. 1996. IL-12: a key cytokine in immune regulation. (Review) Immunol. Today 17: 214.

8. Leonard J P, Sherman M L, Fisher G L, Buchanan L J, Larsen G, Atkins M B, Sosman J A, Dutcher J P, Vogelzang N J, Ryan J L. 1997. Effects of single-dose interleukin-12 exposure on interleukin-12-associated toxicity and interferon-gamma production. Blood 90: 2541.

9. Atkins M B, Robertson M J, Gordon M, Lotze M T, DeCoste M, DuBois J S, Ritz J, Sandler A B, Edington H D, Garzone P D, Mier J W, Canning C M, Battiato L, Tahara H, Sherman M L. 1997. Phase I evaluation of intravenous recombinant human interleukin-12 in patients with advanced malignancies. Clin. Cancer Res. 3: 409.

10. Motzer R J, Rakhit A, Schwartz L H, Olencki T, Malone T M, Sandstrom K, Nadeau R, Parmar H, Bukowski R. 1998. Phase I trial of subcutaneous recombinant human interleukin-12 in patients with advanced renal cell carcinoma. Clin. Cancer Res. 4: 1183.

11. Robertson M J, Cameron C, Atkins M B, Gordon M S, Lotze M T, Sherman M L, Ritz J. 1999. Immunological effects of interleukin-12 administered by bolus intravenous injection to patients with cancer. Clin. Cancer Res. 5: 9.

12. Owen-Schuab L B, Loudon W G, Yagita M, Grimm E A. 1988. Functional differentiation of human lymphokine-activated killing (LAK) is distinct from expansion and involves dissimilar interleukin-2 receptors. Cell. Immunol. 111: 235.

13. Horton S A, Oldham R K, Yannelli J R. 1990. Generation of human lymphokine-activated killer cells following brief exposure to high dose interleukin-2. Cancer Res. 50: 1686.

14. Palmer P A, Scharenberg J G, Von Blomberg B M, Stam A G, Meijer C J, Roest G J, Franks C R, Scheper R J. 1994. Persistent augmentation of natural-killer and T-cell-mediated cytotoxicity in peripheral blood mononuclear cells pulsed in vitro with high-dose recombinant interleukin-2 prior to culturing with a low maintenance dose. Cancer Immunol. Immunother. 39: 34.

15. Provinciali M, Di Stefano G, Stronati S, Fabris N. 1998. Generation of human lymphokine-activated killer cells following an IL-2 pulse in elderly cancer patients. Cytokine 10: 132.

16. Kutza J, Murasko D M. 1996. Age-associated decline in IL-2 and IL-12 induction of LAK cell activity of human PBMC samples. Mech. Ageing Dev. 90: 209.

17. Bloom E T, Thompson W C, Horvath-Arcidiacono J A, Burd P R. 1995. Differential effects of interleukin-12 treatment on gene expression by allostimulated T cells from young and aged mice. Mech. Ageing Dev. 85: 109.

18. Mbawuike I N, Acuna C L, Walz K C, Atmar R L, Greeenberg S B, Couch R B. 1997. Cytokines and impaired CD8⁺ CTL activity among elderly persons and the enhancing effect of
IL-12. Mech. Ageing Dev. 94: 25.

19. Provinciali M, Di Stefano G, Fabris N. 1992. Optimization of cytotoxic assay by target cell retention of the fluorescent dye carboxyfluorescein diacetate (CFDA) and comparison with conventional Cr51-release assay. J. Immunol. Methods 155: 19.

20. Bryant J, Day R, Whiteside T, Herberman R B. 1992. Calculation of lytic units for the expression of cell-mediated cytotoxicity. J. Immunol. Methods 146: 91.

21. Balducci L, Mowrey K, Parker M. 1992. Pharmacology of antineoplastic agents in older patients. In : Balducci L, Lyman G H, Ershler W B. Eds. Geriatric Oncology, Philadelphia, Lippincott Company: 169.

22. Provinciali M, Di Stefano G, Fabris N. 1995. Evaluation of lymphokine-activated killer cell development in young and old health humans. Nat. Immun. 14: 134.

23. Hendrzak J A, Brunda M J. 1995. Interleukin-12. Biologic activity, therapeutic utility, and role in disease. (Review) Lab. Invest. 72: 619.

24. Henkart PA. 1994. Lymphocyte-mediated cytotoxicity: two pathways and multiple effector molecules. (Review) Immunity. 1: 343.

25. Aste-Amezaga M, D'Andrea A, Kubin M, Trinchieri G. 1994. Cooperation of natural killer stimulatory factor/interleukin-12 with other stimuli in the induction of cytokines and cytotoxic cell-associated molecules in human T and NK cells. Cell. Immunol. 156: 480.

26. Buer J, Hilse R, Dallmann I, Grosse J, Kirchner H, Zorn U, Lopez Hanninen E, Franzke A, Duensing S, Poliwoda H, Atzpodien J. 1995. Lymphocyte-conditioned medium in combination with interleukin-2 effectively induces antitumour autoimunity by adoptive transfer of short activated killer (SHAK) cells. Cytokines Mol. Ther. 1: 39.

27. Wigginton J M, Komschlies K L, Back T C, Franco J L, Brunda M J, Wiltrout R H. 1996. Administration of interleukin-12 with pulse interleukin-2 and rapid and complete eradication of murine renal carcinoma. J. Natl. Cancer Inst. 88: 38.