Accueil > Revues > Médecine > European Journal of Dermatology > Texte intégral de l'article
 
      Recherche avancée    Panier    English version 
 
Nouveautés
Catalogue/Recherche
Collections
Toutes les revues
Médecine
European Journal of Dermatology
- Numéro en cours
- Archives
- S'abonner
- Commander un       numéro
- Plus d'infos
Biologie et recherche
Santé publique
Agronomie et Biotech.
Mon compte
Mot de passe oublié ?
Activer mon compte
S'abonner
Licences IP
- Mode d'emploi
- Demande de devis
- Contrat de licence
Commander un numéro
Articles à la carte
Newsletters
Publier chez JLE
Revues
Ouvrages
Espace annonceurs
Droits étrangers
Diffuseurs



 

Texte intégral de l'article
 
  Version imprimable
  Version PDF

Expression of antiapoptotic protein c-FLIP is upregulated in psoriasis epidermis


European Journal of Dermatology. Volume 19, Numéro 1, 29-33, January-February 2009, Investigative report

DOI : 10.1684/ejd.2008.0571

Summary  

Auteur(s) : Jing Yang, Yan Li, Ye-Qiang Liu, Jian-Wen Long, Fen Tian, Jing Dong, Guan-Xin Shen, Ya-Ting Tu, Juan Tao , Department of Dermatology, Affiliated Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China, Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China.

Illustrations

ARTICLE

Auteur(s) : Jing Yang1, Yan Li1, Ye-Qiang Liu1, Jian-Wen Long1, Fen Tian1, Jing Dong1, Guan-Xin Shen2, Ya-Ting Tu1, Juan Tao1

1Department of Dermatology, Affiliated Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China
2Department of Immunology, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

accepté le 12 Août 2008

Psoriasis is chronic, relapsing, inflammatory and hyperproliferative skin disease with a high public health impact [1]. Although altered T-cell activity is certainly involved in eliciting and maintaining inflammation, recent advances in molecular medicine have also suggested possible homeostatic defects in signaling pathways in keratinocytes in psoriasis [2, 3].

Apoptosis has become increasingly recognized as a key mechanism involved in the maintenance of tissue homeostasis, growth and development [4]. In normal human skin, keratinocytes in the superficial layer of the epidermis undergo apoptosis and thereby regulate or balance the proliferation of cells in the basal cell layer [5, 6]. Apoptotic keratinocytes also result in the formation of the stratum corneum [7]. The epidermal hyperplasia characteristic of psoriasis has been implicated to be a result of epidermal expression of apoptosis-related molecules leading to suppression of the apoptotic process [8].

A key inhibitor of death receptor signaling is c-FLIP (cellular FLICE inhibitory protein), which interacts with FADD and procaspase-8, preventing it from binding to caspase-8, thereby inhibiting the initiation of the apoptosis cascade [9, 10]. At same time, the c-FLIP also mediates growth signals by activating NF-κB and ERK pathway in some cases [11].

Overexpression of the anti-apoptotic protein, c-FLIP, in T cells and tumor cells correlates with autoimmunity and tumor in mice and humans, and with resistance to FAS ligand (FAS-L)-mediated cell death [12-14].

In psoriasis, the reasons for the higher proliferating activity and the disturbance in differentiation of keratinocytes are not yet understood. Until now, no studies on the expression of c-FLIP in psoriasis have been reported yet. In the present study, we investigated the expression pattern of anti-apoptosis molecules, c-FLIP, by using real time quantitative RT-PCR and immunohistochemical analyses, and analyzed the association between its expression, proliferation and apoptosis in psoriasis.

Materials and methods

Patients and specimens

Thirty adult patients (older than 18) of both sexes diagnosed with psoriasis at the Department of Dermatology, Affiliated Union Hospital, Tongji Medical College, Huazhong University of Science and Technology were enrolled in the study between 2005 and 2007. Psoriasis was diagnosed by typical clinical features and histology. Patients who had undergone PUVA or received oral therapy up to 4 weeks before biopsy and used topical medications up to 2 weeks before biopsy were excluded. Before treatment the severity of the psoriasis was evaluated using the PASI score (Psoriasis Area and Severity Index) according to Fredriksson & Pettersson [15], and the local skin region was scored on a scale of 0-4 for erythema, induration and desquamation (to give summed scores from 0 to a maximum of 12) according to Smith et al. [16]. In the patients studied, the PASI scores ranged from 5.80 to 29.70 (mean 12.56 ± 5.89); the target plaque scores ranged from 2 to 10 (mean 5.73 ± 2.15).

Biopsy samples of involved and uninvolved psoriatic skin were taken from patients. Uninvolved skin specimens were taken at least 1 cm away from the psoriatic lesion. Twenty samples of normal skin from healthy donors surrounding fibromas or hemangiomas, surgically resected for cosmetic reasons, served as a control group. Informed consent was obtained from all patients before the biopsy. The median age of psoriatic patients was 40.1 (28.0-69.0) years and 35.5 (14.0-63.0) years for healthy controls. There was no significant difference in sex and age between the groups of patients and controls (P = 0.87 and 1.000). All specimens were fixed in 10% buffered formaldehyde and embedded in paraffin. Specimen sections, 4 μm thick, were stained with hematoxylin-eosin, and two different pathologists examined each slide independently.

Immunohistochemical staining

Monoclonal and polyclonal antibodies

Monoclonal mouse anti-human c-FLIP (clone NF6; Alexis, Lausen, Switzerland) and a mouse monoclonal anti-human PCNA antibodies (F-2, sc-25280, Santa Cruz Biotechnology) were used. Streptavidin peroxidase (SP) kit was purchased from Santa Cruz Biotechnology, USA.

Immunohistochemistry

Tissue specimens were fixed in 10% formalin, embedded in paraffin and cut into consecutive sections of 5 μm thickness. The sections were treated with 0.3% hydrogen peroxide to block endogenous peroxidase activity. Following incubation with normal goat serum for 20 min, the sections were incubated for 4 h at room temperature with primary antibodies. And then the slides were incubated with biotin-conjugated secondary antibodies for 30 min. The streptavidin-peroxidase complex was added for 30 min. The colour reaction was developed with diaminobenzidine. Sections were finally counterstained with Mayer hematoxylin and mounted in glycerol gelatin. The staining of negative control sections was performed by replacing the primary antibody with PBS. Coded slides were analyzed using a semiquantitative scoring method (0-4) which has been previously validated in similar studies of immunohistochemistry (0, no staining; 1, < 25%; 2, 25-50%; 3, 50-75%; 4 > 75% staining).

Detection of apoptosis by TUNEL

For detection of apoptotic cells, sections from lesional biopsies of patients and the normal group were stained by TUNEL technique using an in-situ apoptosis detection kit, AP (Roche, CH) according to the supplier’s instructions. The apoptotic index was calculated according to Kikuchi & Nishikawa [17] as follows: Apoptotic index (%) = (n, TUNEL+ ve cells/total 10,000 cells counted) ×100.

SYBR Green real time RT-PCR assay

Total RNA from the epidermis was extracted using the TRIzol reagent (Invitrogen). The purity and concentration of total RNA were detected by an ultraviolet spectrophotometer. 2 μL total RNA was reversely transcribed and synthesized to complementary DNA (cDNA) in 20 μL reaction system using reverse transcriptase (Promega). Equal amounts of cDNA were submitted to PCR, in the presence of SYBR green dye with the QuantiTect SYBR Green RT-PCR Kit (QIAGEN) and the ABI PRISM 6700 Real time PCR detection machine (Fengling Biotechnology Inc.). c-FLIP and the housekeeping gene, GAPDH, were amplified using the primers as follows. Each sample was normalized by using the difference in critical thresholds (CT) between target gene and GAPDH. The following equation was used to describe the result: Δ Δ CT target gene= Δ CT target gene at indicated time -Δ CT target gene at 0h where Δ CT target gene was the difference in CT between target gene and GAPDH, and Δ CT target gene at 0h was the difference between target gene and GAPDH at 0h. The mRNA levels of each sample were then compared using the expression 2- Δ Δ CT target gene. The results of each group were averaged.

c-FLIP: 5’- ATTGGTGAGGATTTGGATAA -3’ (sense primer)

5’-TGGGCGTTTTCTTTCTTGTC-3’ (antisense primer)

GAPDH: 5’-GTCAACGGATTTGGTCGTATTG-3’ (sense primer)

5’-TGGAGGGATCTCGCTCCTGGAAGAT-3’ (antisense primer)

Statistical analysis

Data analysis was performed using the SPSS 11.0 Statistical Software. The statistical significance of the difference in the levels of c-FLIP between the lesional and the non-lesional samples of psoriasis patients was assessed using the Mann-Whitney nonparametric tests. Correlations between c-FLIP, PCNA, AI and the PASI scores were determined using the Bivariate correlations analysis. p < 0.05 was considered statistically significant.

Results

The protein expressions of c-FLIP and PCNA in normal, lesional and non-lesional psoriatic skin

The expression and localization of c-FLIP and PCNA in normal, nonlesional and lesional psoriatic skin were determined by immunohistochemical analyses (figure 1). In normal and non-lesional psoriatic skin, PCNA exhibited a clear nuclear localization in the basal layer of the epidermis (figures 1A and B), whereas many PCNA-positive nuclei were seen in the keratinocytes of all epidermal layers in the lesional psoriatic skin (figure 1C). c-FLIP was strongly expressed in cytoplasms of keratinocytes within all epidermal layers in lesional psoriatic skin, especially in the granular and spinous layers (figure 1D), whereas weak c-FLIP staining was restricted to the basal and suprabasal layers of the epidermis in non-lesional psoriatic and normal skin (figures 1E and F). c-FLIP expression was significantly higher in lesional vs. normal and non-lesional skin (P < 0.01, for both). The eccrine sweat glands, hair follicles and sebaceous glands showed a weak expression of c-FLIP in normal and psoriatic skin.

Apoptosis in psoriatic and normal skin

The apoptotic index was evaluated in psoriatic biopsies and normal skins (table 1). There were few apoptotic keratinocytes or lymphocytes detected in lesional psoriatic skin (figure 2A) However, apoptotic keratinocytes and lymphocytes were observed in normal and non-lesional psoriatic skin. And apoptosis was more noticeable in keratinocytes than in lymphocytes in normal skin and non-lesional psoriatic skin (figure 2B and C).
Table 1 Apoptotic index in psoriatic and normal skin

Number

AI%

Psoriasis skin

Differentiated

30

8.5±1.16

Germinative

30

5.2±1.78

Uninvolved psoriatic skin

Differentiated

30

30.9±3.69

Germinative

30

19.7±3.95

Normal skin

Differentiated

20

31.2±2.57

Germinative

20

18.5±2.53

Correlation between c-FLIP, PASI score, local target region score, PCNA and AI

Although the absolute level of c-FLIP expression varied from patient to patient, its expression in lesional epidermis was significantly higher (p < 0.05) than that in non-lesional epidermis and normal skin. When the PASI score and local target region score were applied, there was a significant positive correlation between c-FLIP expression in the lesional epidermis and the PASI score, target region score (Spearman’s rho = 0.83, rho = 0.80 p < 0.05). And there was a similar correlation between c-FLIP expression and PCNA (Spearman’s rho = 0.61, p < 0.05). However there was a negative correlation between c-FLIP expression and AI (Spearman’s rho = – 0.41, p < 0.05).

The mRNA expression of cFLIP in lesional, non-lesional psoriatic skin and normal skin

c-FLIP mRNA expression was detected in all clinically involved psoriasis biopsies by real time RT-PCR. Although inter-individidual differences in c-FLIP mRNA expression were observed, the level of c-FLIP mRNA expression in lesional psoriatic skin was higher compared with non-lesional psoriatic skin and normal skin. Furthermore, the elevation of the mean c-FLIP mRNA expression in lesional psoriatic skin compared with non-lesional psoriatic skin, normal skin was statistically significant (figure 3; 3.8-fold; 3.6-fold, P < 0.01, Mean ± SEM).

Discussion

Upregulation of cell survival pathways and suppression of apoptosis are implicated in the development of psoriasis. In previous reports, the anti-apoptotic molecules, primarily of the Bcl-2 family [8] and survivin [18] were high expressed in psoriasis. The Bcl-2 family, such as Bcl-2, Bcl-xL could interact with Bax and then inhibit the apoptotic effect of Bax [19, 20]. Survivin is the member of the inhibitor of apoptosis family which is upregulated during the G2M phase of cellcycle and is known as a regulator of mitosis [21].

Recently, c-FLIP has been identified as an inhibitor of apoptosis triggered by engagement of death receptors such as Fas or TRAIL (TNF-related apoptosis-inducing ligand) [9, 10]. Dysregulation of c-FLIP expression has been shown to be associated with various diseases, such as cancer and autoimmune diseases [12-14]. Because little is known about c-FLIP expression with respect to psoriasis, we analyzed c-FLIP expression immunohistochemically in biopsies of normal and psoriatic skin. This study showed that the level of c-FLIP was significantly increased in lesional psoriatic epidermis compared with normal and non-lesional psoriatic epidermis. And its localization was within all the epidermal layers in lesional psoriatic skin, especially in the granular and spinous layers, whereas weak c-FLIP staining was restricted to the basal and suprabasal layers of the epidermis in normal and non-lesional psoriatic skin. As the level of c-FLIP increases, caspase-8 activation is inhibited, eventually leading to inhibition of cell apoptosis and an increase of cell proliferation [10]. c-FLIP was upregulated to levels sufficient to prevent death receptor-induced apoptosis in many human tumor cells, including colorectal cancer [22], melanoma [23], and ovarian carcinoma [24]. Therefore our results implicate c-FLIP expression as an important mechanism protecting keratinocytes from apoptotic elimination. In this regard, it has been reported that decreased c-FLIP levels enhance the sensitivity of tumor cells not only to Fas but also to TNF-related apoptosis induced ligand (TRAIL)-mediated apoptosis [25]. These data render c-FLIP an attractive candidate to predict the effectiveness of future immune therapies in colon cancer [26]. Therefore c-FLIP might be a potential new target for preventing keratinocyte proliferation in psoriasis in the future.

To determine the role of increased c-FLIP on the severity of psoriasis, we evaluated the relationship between the PASI score, the target region score and c-FLIP protein. The correlation between c-FLIP expression in lesional epidermis and the PASI scores showed a significant positive correlation. This result indicated that increased levels of c-FLIP in psoriatic skin were highly related to the clinical severity of psoriasis. We also observed increased levels of c-FLIP expression in lesional epidermis with psoriasis, together with increased levels of PCNA, but with decreased levels of AI. This suggested that the increased levels of c-FLIP might induce upregulation of keratinocyte proliferation and downregulation of the apoptotic signaling pathway in psoriatic epidermis. Several lines of evidence strengthen this finding. c-FLIP has recently been shown to be an important mediator of nuclear factor-κB and pI3/Akt-controlled anti-apoptotic signals in cells [11]. c-FLIP is associated with the generation of positive signals for cell proliferation by activation of the ERK pathway through Raf-1 binding [11]. These results further indicate that c-FLIP might contribute to keratinocyte hyperproliferation in psoriasis. Several antipsoriatic agents also inhibit keratinocyte proliferation and increase keratinocyte apoptosis. These include propylthiouracil [27], steroids [28], methotrexate [29], cyclosporine A [30] and calcipotriol [28]. Further investigation is required to identify whether c-FLIP takes part in promoting the keratinocyte apoptosis induced by these antipsoriatic agents in psoriasis.

Quantitative RT-PCR analysis was performed to investigate whether the increased c-FLIP protein level was paralleled by an increased accumulation of the corresponding mRNA in psoriatic skin. The expression of c-FLIP was dramatically upregulated at the mRNA as well as at the protein level in hyperproliferative lesional skin from psoriasis patients. Significant differences in c-FLIP mRNA expression were observed in lesional psoriatic epidermis compared with normal and non-lesional psoriatic epidermis, demonstrating a transcriptional regulation of c-FLIP expression in psoriatic skin. The mechanism of c-FLIP transcriptional regulation in psoriasis will be further studied in the future.

Conclusion

In conclusion, we have shown that increased c-FLIP expression in psoriatic skin is closely related to the clinical severity of psoriasis and has a positive correlation with keratinocyte proliferation and a negative correlation with keratinocyte apoptosis in psoriasis. These results suggest that anti-apoptotic c-FLIP protein may play a prominent role in psoriasis epidermal hyperplasia.

Acknowledgements

Financial support: none. Conflict of interest: none.

References

1 Barker J. Skin diseases with high public health impact. Psoriasis. Eur J Dermatol 2007; 17: 563-4.

2 Karvonen SL, Korkiamaki T, Yla-Outinen H, et al. Psoriasis and altered calcium metabolism: downregulated capacitative calcium influx and defective calcium-mediated cell signaling in cultured psoriatic keratinocytes. J Invest Dermatol 2000; 114: 693-700.

3 Elder JT, Nair RP, Voorhees JJ. Epidemiology and the genetics of psoriasis. J Invest Dermatol 1994; 102: 24S-27S.

4 Raskin CA. Apoptosis and cutaneous biology. J Am Acad Dermatol 1997; 36: 885-96; (quiz 97-8).

5 Polakowska RR, Piacentini M, Bartlett R, et al. Apoptosis in human skin development: morphogenesis, periderm, and stem cells. Dev Dyn 1994; 199: 176-88.

6 Weil M, Raff MC, Braga VM. Caspase activation in the terminal differentiation of human epidermal keratinocytes. Curr Biol 1999; 9: 361-4.

7 Ishida-Yamamoto A, Tanaka H, Nakane H, et al. Programmed cell death in normal epidermis and loricrin keratoderma. Multiple functions of profilaggrin in keratinization. J Investig Dermatol Symp Proc 1999; 4: 145-9.

8 Takahashi H, Manabe A, Ishida-Yamamoto A, et al. Aberrant expression of apoptosis-related molecules in psoriatic epidermis. J Dermatol Sci 2002; 28: 187-97.

9 Krueger A, Baumann S, Krammer PH, et al. FLICE-inhibitory proteins: regulators of death receptor-mediated apoptosis. Mol Cell Biol 2001; 21: 8247-54.

10 Thome M, Tschopp J. Regulation of lymphocyte proliferation and death by FLIP. Nat Rev Immunol 2001; 1: 50-8.

11 Kataoka T, Budd RC, Holler N, et al. The caspase-8 inhibitor FLIP promotes activation of NF-kappaB and Erk signaling pathways. Curr Biol 2000; 10: 640-8.

12 Xu L, Zhang L, Yi Y, et al. Human lupus T cells resist inactivation and escape death by upregulating COX-2. Nat Med 2004; 10: 411-5.

13 van Houdt IS, Muris JJ, Hesselink AT, et al. Expression of c-FLIP is primarily detected in diffuse large B-cell lymphoma and Hodgkin’s lymphoma and correlates with lack of caspase 8 activation. Histopathology 2007; 51: 778-84.

14 Mathas S, Lietz A, Anagnostopoulos I, et al. c-FLIP mediates resistance of Hodgkin/Reed-Sternberg cells to death receptor-induced apoptosis. J Exp Med 2004; 199: 1041-52.

15 Fredriksson T, Pettersson U. Severe psoriasis--oral therapy with a new retinoid. Dermatologica 1978; 157: 238-44.

16 Smith CH, Jackson K, Chinn S, et al. A double blind, randomized, controlled clinical trial to assess the efficacy of a new coal tar preparation (Exorex) in the treatment of chronic, plaque type psoriasis. Clin Exp Dermatol 2000; 25: 580-3.

17 Kikuchi A, Nishikawa T. Apoptotic and proliferating cells in cutaneous lymphoproliferative diseases. Arch Dermatol 1997; 133: 829-33.

18 Bowen AR, Hanks AN, Murphy KJ, et al. Proliferation, apoptosis, and survivin expression in keratinocytic neoplasms and hyperplasias. Am J Dermatopathol 2004; 26: 177-81.

19 Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993; 74: 609-19.

20 Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 1998; 281: 1322-6.

21 Li F, Ambrosini G, Chu EY, et al. Control of apoptosis and mitotic spindle checkpoint by survivin. Nature 1998; 396: 580-4.

22 Wilson TR, McLaughlin KM, McEwan M, et al. c-FLIP: a key regulator of colorectal cancer cell death. Cancer Res 2007; 67: 5754-62.

23 Irmler M, Thome M, Hahne M, et al. Inhibition of death receptor signals by cellular FLIP. Nature 1997; 388: 190-5.

24 Abedini MR, Qiu Q, Yan X, et al. Possible role of FLICE-like inhibitory protein (FLIP) in chemoresistant ovarian cancer cells in vitro. Oncogene 2004; 23: 6997-7004.

25 Wang Q, Wang X, Zhou Y, et al. PKCdelta-mediated regulation of FLIP expression in human colon cancer cells. Int J Cancer 2006; 118: 326-34.

26 Galligan L, Longley DB, McEwan M, et al. Chemotherapy and TRAIL-mediated colon cancer cell death: the roles of p53, TRAIL receptors, and c-FLIP. Mol Cancer Ther 2005; 4: 2026-36.

27 Elias AN, Barr RJ. Enhanced apoptosis in psoriatic plaques after treatment with propylthiouracil. Eur J Dermatol 2007; 17: 353-4.

28 Adisen E, Gulekon A, Erdem O, et al. The effects of calcipotriol and methylprednisolone aseponate on bcl-2, p53 and ki-67 expression in psoriasis. J Eur Acad Dermatol Venereol 2006; 20: 527-33.

29 Heenen M, Laporte M, Noel JC, et al. Methotrexate induces apoptotic cell death in human keratinocytes. Arch Dermatol Res 1998; 290: 240-5.

30 Sugie N, Fujii N, Danno K. Cyclosporin-A suppresses p53-dependent repair DNA synthesis and apoptosis following ultraviolet-B irradiation. Photodermatol Photoimmunol Photomed 2002; 18: 163-8.


 

Qui sommes-nous ? - Contactez-nous - Conditions d'utilisation - Paiement sécurisé
Actualités - Les congrès
Copyright © 2007 John Libbey Eurotext - Tous droits réservés
[ Informations légales - Powered by Dolomède ]