ARTICLE
Auteur(s) : Young Jin Choi1, Tae Jin
Yoon2, Young Ho
Lee1
1Department of Anatomy, College of Medicine, Chungnam
National University, 6 Moonwha-dong, Jung-gu, Daejeon 301-131,
Korea
2Department of Dermatology, School of Medicine,
Gyeongsang National University, 90 Chilam-dong, Jinju 660-702,
Korea
accepté le 27 Mars 2008
Hair graying is one of the prototypical signs of human aging,
and the maintenance of hair pigmentation is dependent on the
presence and functionality of melanocytes, which are derived from
neural crest cells and synthesize pigment for growing hair [1-3].
The mechanism of hair graying, however, has remained unclear.
Hair graying results from a reduction in tyrosinase activity of
hair bulbar melanocytes due to the cytotoxic oxidative nature of
melanin biosynthesis, suboptimal melanocyte-cortical keratinocyte
interactions, and defective migration of melanocytes from a
reservoir in the upper outer root sheath to the pigment-permitting
microenvironment close to the dermal papilla of the hair bulb [4,
5]. Recently, Nishimura et al. [6] demonstrated that hair graying
is caused by defective self-maintenance of melanocyte stem cells
(MSCs). This process is accelerated dramatically with Bcl2
deficiency, which causes the selective apoptosis of MSCs but not
differentiated melanocytes within the niche at their entry into the
dormant state. The physiological aging of MSCs is associated with
ectopic pigmentation or differentiation within the niche, a process
accelerated by mutation of the melanocyte master transcriptional
regulator, microphthalmia transcription factor (MITF).
Melanocytes are derived from the neural crest and differentiate
under the control of MITF, a basic helix-loop-helix leucine zipper
transcription factor that activates genes involved in pigment
production (e.g., dopachrome tautomerase (Dct), tyrosinase (Tyr),
and tyrosine related protein-1 (TRP-1)) and melanocyte survival
(e.g., Bcl2) [7-9]. MITF consists of at least six isoforms, called
MITF-M, MITF-A, MITF-B, MITF-C, MITF-H, and MITF-J [10, 11].
Pax3 activates the expression of MITF, a transcription factor
critical for melanogenesis, while it simultaneously competes with
MITF for occupancy of an enhancer required for the expression of
Dct, an enzyme that functions in melanin synthesis [12, 13].
Sox10 binds to the MITF promoter directly and activates
transcription. The ability of Sox10 to activate transcription of
the MITF promoter implicates Sox10 in the regulation of melanocyte
development and provides a molecular basis for hypopigmentation
[14, 15].
In this study, we further elucidated the mechanism of hair
graying by investigating the gene expression related to
melanogenesis in human hair.
Materials and methods
Materials
Black and white hairs were plucked from six fresh cadavers (32-58
years of age, mean 46.6 years) donated for medical research and
education at the Department of Anatomy, College of Medicine,
Chungnam National University in Korea. The hair bulbs were obtained
from these hairs.
RT-PCR
Total RNA was isolated from the black and white hairs using TRIzol
Reagent (Invitrogen, Carlsbad, CA, USA) according to the
manufacturer’s instructions. Approximately 10 μg of total RNA
from the hairs was used to generate cDNA in a 40-μL reaction using
200 units of SuperScript II (Invitrogen) reverse transcriptase and
an oligo dT primer. Subsequently, 2 μL of the cDNA was used to
analyze the presence of common MITF, Tyr, TRP-1, TRP-2, Pax3, and
Sox10 using PCR amplification. The 5′ and 3′ primers for each gene
are listed in table 1. In addition, 2 μL
of the cDNA was used to analyze the presence of each isoform using
PCR amplification with isoform-specific 5′ primers for MITF
together with a common 3′ primer [Supplementary table 1 in Reference No. 10]. As a control for cDNA
levels, primers for GAPDH were used.
Table 1 PCR primers for common MITF, Tyr, Pax3, Sox10,
TRP-1, and TRP-2
|
Gene
|
Primer sequence
|
|
Common MITF
|
5’-Primer CCCGGTGCAGAATTCTAACT
|
|
3’-Primer AAGCATCCGCAAGAGACAGT
|
|
Tyr
|
5’-Primer AGGCAGAGGTTCCTGTCAGA
|
|
3’-Primer CTATGCCAAGGCAGAAAAGC
|
|
Pax3
|
5’-Primer AGCACCCCAATCAGATGAAG
|
|
3’-Primer TGTCTGGGTTGGAAGGAATC
|
|
Sox10
|
5’-Primer GCCAGATCAAAGGTCTCCAT
|
|
3’-Primer TGCAGCACAAGAAAGACCAC
|
|
TRP-1
|
5’-Primer CTCCTGCACACCTTCACAGA
|
|
3’-Primer TCAGTGAGGAGAGGCTGGTT
|
|
TRP-2
|
5’-Primer TCCCAATCCTGAAAGTCACC
|
|
3’-Primer GCCAGGTAACAAATGCAGGT
|
Results
mRNA for Tyr, MITF, TRP-1, and TRP-2, which are related to
melanogenesis, was expressed in black hair. The expression of the
Tyr, TRP-1, and TRP-2 genes decreased markedly (or was nearly
absent) in white hair compared to black hair. In contrast, exon 9
common to the MITF genes was expressed moderately in white hair,
albeit at levels lower than in black hair (figure 1). That is,
expression of the Tyr and TRP-1 genes decreased markedly in white
hair compared to black hair, while, unexpectedly, MITF gene
expression did not decrease notably in white hair compared to black
hair.
Then, we performed RT-PCR for MITF isoforms with
isoform-specific primers. In addition to MITF-M, the MITF-A, -C,
-D, -H, and -J genes were expressed highly in black hair, while
MITF-B and -E were expressed weakly compared to the other isoforms.
In contrast, MITF-M was not expressed in white hair, while the
other MITF isoforms were expressed similarly in both white and
black hairs (figure
2).
We measured the expression of the Pax3 and Sox10 genes, which
are key transcriptional factors of MITF-M, in black and white hairs
and found that the MITF-M, Pax3, and Sox10 genes were expressed in
black hair, but not in white hair (figure 3).
Discussion
Our findings indicated that expression of the key molecules in
melanogenesis, MITF-M, Sox10, Pax3, TRP-1, and Tyr, were absent or
greatly reduced in the bulbs of white hair compared to black hair.
Of the MITF isoforms (MITF-A, -J, -C, -Mc, -E, -H, -D, -B, and
-M), only the MITF-M isoform was previously reported to be
expressed in hair [11, 16]. MITF-D is expressed in the retinal
pigment epithelium, and is involved in melanogenesis controlling
Tyr expression. However, we also found that MITF-A, -C, -H, and -J
were expressed highly in black and white hairs compared to the
other MITF isoforms, while MITF-D was not detected. Interestingly,
MITF-M was highly expressed in black hair, but was not detected in
white hair. Exon 9, which is common to MITF, was moderately
expressed in white hair compared to the molecules involved in
melanogenesis: Tyr and TRP-1. These data show that various MITF
isoforms are expressed in human hair. The switching-off of MITF-M
expression in the white hair bulb was a novel finding and is an
important clue for elucidating the mechanism of hair graying.
MITF-M is expressed in melanocytes in the hair bulb and in the
MSCs in the bulge area of hair [6, 13]. MSCs in the hair bulge
migrate into the hair bulb and become melanocytes. Our finding that
MITF-M expression is absent in the bulb area of white hair provides
two possible explanations for hair graying. First, MSCs from the
bulge area migrate into the bulb area, but cannot produce MITF-M
and other molecules related to melanogenesis; i.e., they become
amelanogenic melanocytes. Alternatively, MSCs do not migrate into
the bulb area from the bulge area, and so melanocytes are not
present in the bulb area of white hair. In this study, Sox10, Pax3,
and MITF-M were not detected in the hair bulbs of white hair. MSCs
or melanocytes express markers for neural crest cells, i.e., Sox10
and Pax3 [12, 14, 15]. Therefore, our results suggest that MSCs in
the bulge area do not migrate into the bulb area of white hair.
In conclusion, our study provides data supporting the recently
proposed mechanism of hair graying: hair graying is caused by
defective migration of MSCs into the bulb area of hair.
Acknowledgement
This study was supported by Chungnam National University Research
Fund 2005. Conflict of interest: none.
References
1 Sarin KY, Artandi SE. Aging, graying and loss of
melanocyte stem cells. Stem Cell Rev 2007; 3: 212-7.
2 Lin JY, Fisher DE. Melanocyte biology and skin
pigmentation. Nature 2007; 445: 843-50.
3 Kerscher M, Williams S, Dubertret L. Cosmetic
dermatology and skin care. Eur J Dermatol 2007; 17: 180-2.
4 Tobin DJ, Paus R. Graying: gerontobiology of the
hair follicle pigmentary unit. Exp Gerontol 2001; 36: 29-54.
5 Van Neste D, Tobin DJ. Hair cycle and hair
pigmentation: dynamic interactions and changes associated with
aging. Micron 2004; 35: 193-200.
6 Nishimura EK, Granter SR, Fisher DE. Mechanisms
of hair graying: incomplete melanocyte stem cell maintenance in the
niche. Science 2005; 307: 720-4.
7 Steingrímsson E, Copeland NG, Jenkins NA.
Melanocytes and the microphthalmia transcription factor network.
Annu Rev Genet 2004; 38: 365-411.
8 McGill GG, Horstmann M, Widlund HR, Du J,
Motyckova G, Nishimura EK, Lin YL, Ramaswamy S,
Avery W, Ding HF, Jordan SA, Jackson IJ,
Korsmeyer SJ, Golub TR, Fisher DE. Bcl2 regulation
by the melanocyte master regulator Mitf modulates lineage survival
and melanoma cell viability. Cell 2002; 109: 707-18.
9 Widlund HR, Fisher DE. Microphthalamia-associated
transcription factor: a critical regulator of pigment cell
development and survival. Oncogene 2003; 22: 3035-41.
10 Takeda K, Yasumoto K, Kawaguchi N,
Udono T, Watanabe K, Saito H, Takahashi K,
Noda M, Shibahara S. Mitf-D, a newly identified isoform,
expressed in the retinal pigment epithelium and monocyte-lineage
cells affected by Mitf mutations. Biochim Biophys Acta 2002; 1574:
15-23.
11 Hershey CL, Fisher DE. Genomic analysis of the
Microphthalmia locus and identification of the MITF-J/Mitf-J
isoform. Gene 2005; 347: 73-82.
12 Lang D, Lu MM, Huang L, Engleka KA,
Zhang M, Chu EY, Lipner S, Skoultchi A,
Millar SE, Epstein JA. Pax3 functions at a nodal point in
melanocyte stem cell differentiation. Nature 2005; 433: 884-7.
13 Steingrímsson E, Copeland NG, Jenkins NA.
Melanocyte stem cell maintenance and hair graying. Cell 2005; 121:
9-12.
14 Wong CE, Paratore C, Dours-Zimmermann MT,
Rochat A, Pietri T, Suter U, Zimmermann DR,
Dufour S, Thiery JP, Meijer D, Beermann F,
Barrandon Y, Sommer L. Neural crest-derived cells with
stem cell features can be traced back to multiple lineages in the
adult skin. J Cell Biol 2006; 175: 1005-15.
15 Lee M, Goodall J, Verastegui C,
Ballotti R, Goding CR. Direct regulation of the
Microphthalmia promoter by Sox10 links Waardenburg-Shah syndrome
(WS4)-associated hypopigmentation and deafness to WS2. J Biol Chem
2000; 275: 37978-83.
16 Tachibana M. MITF: a stream flowing for pigment cells.
Pigment Cell Res 2000; 13: 230-40.
|
Version imprimable
Version PDF
