Accueil > Revues > Médecine > European Journal of Dermatology > Texte intégral de l'article
 
      Recherche avancée    Panier    English version 
 
Nouveautés
Catalogue/Recherche
Collections
Toutes les revues
Médecine
European Journal of Dermatology
- Numéro en cours
- Archives
- S'abonner
- Commander un       numéro
- Plus d'infos
Biologie et recherche
Santé publique
Agronomie et Biotech.
Mon compte
Mot de passe oublié ?
Activer mon compte
S'abonner
Licences IP
- Mode d'emploi
- Demande de devis
- Contrat de licence
Commander un numéro
Articles à la carte
Newsletters
Publier chez JLE
Revues
Ouvrages
Espace annonceurs
Droits étrangers
Diffuseurs



 

Texte intégral de l'article
 
  Version imprimable
  Version PDF

Improvement of the dermal epidermal junction in human reconstructed skin by a new c-xylopyranoside derivative


European Journal of Dermatology. Volume 18, Numéro 3, 297-302, May-June 2008, Investigative report

DOI : 10.1684/ejd.2008.0392

Summary  

Auteur(s) : Juliette Sok, Nathalie Pineau, Maria Dalko-Csiba, Lionel Breton, Françoise Bernerd , L’Oréal Recherche, Centre de Recherche C Zviak, 90 rue du Général Roguet, 92583 Clichy Cedex, France.

Illustrations

ARTICLE

Auteur(s) : Juliette Sok, Nathalie Pineau, Maria Dalko-Csiba, Lionel Breton, Françoise Bernerd

L’Oréal Recherche, Centre de Recherche C Zviak, 90 rue du Général Roguet, 92583 Clichy Cedex, France

accepté le 15 Janvier 2008

As a result of improved life expectancy, the proportion of people over 55 has been continuously increasing, which has raised growing needs to reduce visible signs of aging [1]. Skin aging is characterized by wrinkle formation and the sagging associated with a decrease in dermal density and strength. Ultrasound studies have given evidence of alterations in the superficial dermis in aged skin, reflecting a decreased density [2, 3]. From a biological point of view, significant histological changes occur within the dermis accompagnied by an increased degradation of extracellular matrix (ECM) through up-regulation of MMP production as well as a decrease in collagen content and synthesis [4-6]. Structural modifications of the superficial dermis during the aging process have to be paralleled with considerable alterations of dermal epidermal junction (DEJ). One of the major morphological features of aged skin is a flattening of DEJ outline with the loss of rete pegs and re-duplication of the lamina densa [7]. From that point of view DEJ changes are considered as crucial markers of skin aging [8]. At the structural level, DEJ consists of four distinct stacked zones including, from epidermis to dermis: 1) plasma membrane and hemidesmosomes belonging to basal keratinocytes, 2) lamina lucida containing laminin 5, 3) lamina densa mostly consisting of type IV collagen, perlecan and nidogen, and 4) a sublamina fibrillar zone containing anchoring fibrils of type VII collagen [9, 10]. A preferential accumulation of several ECM proteins such as fibers of pro-collagens type I and III, and microfibrils of fibrillin 1 is observed in this upper part of the papillary dermis. Several of these components have been shown to be altered and reduced in aged skin. Collagen VII, which is responsible for anchoring the basement membrane onto dermal matrix, decreases with aging [11]. This reduction has been shown to represent an important biochemical marker of wrinkles [12]. During aging, the papillary dermis tends to be reduced which could be related to decreased expression of procollagen 1 [4, 13] and fibrillin 1 [14]. Since the DEJ is involved in the cohesion between the dermis and epidermis but also provides a dynamic interface for the regulation of soluble factor exchanges between the two compartments [15, 16], age-related alterations entail functional changes in skin resistance to mechanical stress [17] and tissue homeostasis [18-20].

Previous data from our laboratory showed that the use of a human complete reconstructed skin in vitro allowed de novo morphogenesis of the dermal epidermal junction to be investigated [21]. Respective participation and interactions of both cell types could be assessed in a kinetic view. In addition, the model allowed the beneficial effects of products on DEJ formation to be assessed [22]. A new xylopyranoside derivative (C-Xyloside, Pro-xylaneTM) was recently developed and shown to induce biological activity such as increased glycosaminoglycan (GAGs) and heparan sulfate-proteoglycan (HS-PGs) synthesis [23], such as syndecan [24], and perlecan, a mixed heparan sulfate/chondroitin sulfate proteoglycan [25] localized at the skin basement membrane zone. The present study was designed to analyze the biological effects of C-Xyloside on dermal-epidermal junction morphogenesis in the reconstructed skin model, with particular attention on the fibrillar and structural components of the DEJ.

Materials and methods

Keratinocyte and fibroblast cultures

Normal human skin was obtained from mammary reduction after patient’s informed consent. Normal human epidermal keratinocytes (NHK) were isolated and cultured as described by Rheinwald and Green on a feeder layer of Swiss 3T3 fibroblasts [26]. Human dermal fibroblasts were isolated after spreading from mammary skin explants and cultured in DMED 10% fetal calf serum.

In vitro reconstructed skin [27]

Dermal equivalents were prepared using 7 mL of a mixture containing 106 human dermal fibroblasts and 1.5 mg/mL native bovine type I collagen (Symatèse, France) in a 60 mm petri dish. The dermal equivalents were allowed to contract for 3 days at 37 °C, 5% CO2. Human epidermal keratinocytes grown in primary culture (33,000/cm2) were seeded on this support using stainless rings. After 2 h rings were removed and cultures were kept submerged for 7 days. The culture was then raised at the air-liquid interface (day 0) and kept up for 8 or 11 days. The medium was as described [28] and changed 3 times per week.

Test product and treatment

C-β-D-xylopyranoside-2-hydroxy-propane (C-Xyloside, Pro-xylaneTM) was obtained from L’Oréal Research Laboratories (France). It was freshly prepared before each use and diluted in culture medium. Cytotoxicity was assessed using the MTT test in dermal fibroblasts, seeded at 12,500 cells per well (96 well plates), cultured for 24 hours without (control) then for 24 hours with test product (C-Xyloside treated) before MTT test.

For gene expression analysis, human dermal fibroblasts were treated with C-Xyloside in a medium containing 1% fetal calf serum for 18h. Each experiment was performed in triplicate.

For DEJ protein analysis, reconstructed skin samples were treated with C-Xyloside added to culture medium from the last medium change of the immersion phase, and then at each medium change during the emerged culture period (air-liquid interface). Five different experiments were done using duplicates for each experimental condition.

Histology

Reconstructed skin samples were fixed in neutral formalin. Paraffin sections were stained with haematoxylin, eosin, and saffron.

Immunostaining

Immunolabelling was performed on air-dried vertical 5 μm cryosections of reconstructed skin samples. Mouse monoclonal antibodies were against: human type IV collagen (CIV22, Dako, Denmark, 1/10); type VII collagen (LH7.2 Chemicon Inter, USA, 1:200); fibrillin-1 (11C1.3, Southern Biotechnology Associates, USA, 1:50), laminin 5 (clone GB3, gift from Dr G Meneguzzi, Nice France, undiluted). Rat monoclonal antibodies were against type I procollagen (M-58, Chemicon Inter, USA, 1:100). Fluorescein isothiocyanate (FITC)-conjugate rabbit anti-mouse immunoglobulins (1:80) or FITC-conjugate swine anti-rabbit immmunoglobulins (1:40) or FITC-conjugate rabbit anti-rat immmunoglobulins (1:200), (Dako, Denmark), were used as second antibodies. Nuclear counterstaining using propidium iodide was carried out routinely.

Ten different fields per experimental condition were quantified for staining intensity using the Q-Fluoro Leica software. Values are given as arbitrary units.

RNA extraction and quantitative PCR

Dermal fibroblasts were rinsed in PBS Dulbecco’s without calcium and magnesium (Gibco BRL), immersed in Tri-Reagent (Sigma T9424). Total RNA was extracted according to manufacturer’s instructions followed by chloroform extraction and isopropanol precipitation. Contaminant DNA was removed using DNA-free system (Ambion) according to manufacturer’s instructions.

Reverse transcription was performed in the presence of oligo (DT) primer and Superscript II enzyme (Gibco). Quantification of cDNA was performed and adjusted at 50 ng/mL. Quantitative PCR were performed using the Light Cycler (Roche Molecular Systems, Inc.) according to manufacturer’s instructions. Primers were designed to be specific for collagen IV α1 chain (Forward CCTCGCTGTGGATCGGCTACTC, Reverse GCTTCTTGAACATCTCGCTCCTCTC) and collagen VII α1 chain (Forward GGCTCGCACTGACGCTTCTG, Reverse TCCAGCAGAGTGTAGAGTGTGAGG). Normalization of the quantities of mRNA was performed using a beta actin gene (Forward GGACTTCGAGCAAGATGG Reverse AGGAAGGAAGGCTGGAAGAG). Levels for mRNA were expressed in arbitrary units. The mRNA levels of the gene concerned were considered 100% for the untreated condition. Experiments were performed in triplicate.

Statistical analysis

The statistical significance was determined with Student’s t test (p < 0.05 was considered to be statistically significant).

Results

Cytotoxicity assessement

Dermal fibroblasts were incubated with increasing concentration (ranging from 0 to 10 mg/mL) of C-Xyloside for 24 hours. MTT test was performed and revealed no cytotoxic effects even at high concentration (table 1).
Table 1 Evaluation of cytotoxicity according to C-Xyloside concentration added to culture medium. Morphological score +: normal aspect, ±: slight morphological changes, -: cytotoxic effect, decrease in cell number

C-Xyloside Concentration (mg/mL)

0

1.28 10-4

6 10-4

0.032

0.016

0.08

0.4

2

10

MTT Values

100

95

93

92

93

93

106

96

97

Morphological score

+

+

+

+

+

+

+

±

±

mRNA levels for collagen VII α1 and collagen IV α1 in dermal fibroblasts

Concentrations of 0.08 and 0.4 mg/mL of C-Xyloside were chosen to assess their effect on gene expression. Treatment of dermal fibroblasts with C-Xyloside for 18 h induced an increase in mRNA levels for collagen VII α1 by 201% (p < 0.01) at 0.08 mg/mL and 357% at 0.4 mg/mL (p < 0.01). Collagen IV α1 gene expression was slightly increased by 112% at 0.08 mg/mL (not significant) and 136% at 0.4 mg/mL (tendency, p = 0.13) compared to control cells.

C-Xyloside does not interfere with the epidermal morphogenesis of reconstructed skin models

Histological examinations of the samples of reconstructed skin were performed at day 8 of the air liquid interface culture period, which corresponds to the time needed for a complete epidermal differentiation and formation of the horny layer [29]. Some samples were also analysed at day 11 of air-liquid interface period. Test concentrations of C-Xyloside were 0.08 mg/mL and 0.16 mg/mL.

Control reconstructed skins at day 8 present a fully differentiated epidermis with granular and horny layers (figure 1). At day 11, the thickness of horny layer was increased. Morphological analysis of reconstructed skins treated with C-Xyloside revealed a normal appearance without any alterations in the epidermal differentiation (figure 1). Even at day 11, C-Xyloside-supplemented reconstructed skins displayed similar morphological features compared to controls.

Histological examination of dermal fibroblasts embedded in the collagen matrix did not reveal differences between control and C-Xyloside treated samples (figure 1).

C-Xyloside improves the deposition of basement membrane proteins in the reconstructed skin model

The reconstructed skin model in vitro based on the use of contracted collagen gel as a dermal support needs a complete de novo morphogenesis of the basement membrane compartment to achieve a functional DEJ [21]. The deposition of specific DEJ proteins such as type IV collagen, type VII collagen and laminin 5 were analysed by immunostaining. At day 8, these proteins were weakly expressed in control samples and often visualized as a punctiform staining at the DEJ zone. In C-Xyloside exposed samples, increased levels of these proteins were found at DEJ area with a linear distribution (table 2, figure 2).
Table 2 Quantitative analysis of immunostainings. Treated samples were compared to control samples and statistical analysis was performed using the Student’s t test (** p < 0.05)

Control

C-Xyloside 0.08 mg/mL

C-Xyloside 0.16 mg/mL

Collagen IV

55.59 ± 1.22

60.84 ± 1.78 ** (p = 0.031)

69.74 ± 0.99 ** (p < 0.001)

Collagen VII

53.22 ± 0.37

56.74 ± 0.88 ** (p = 0.001)

59.88 ± 1.85 ** (p = 0.002)

Laminin 5

68.34 ± 0.43

76.25 ± 1.32** (p < 0.001)

70.57 ± 0.90** (p = 0.034)

Pro-collagen I

58.51 ± 1.38

74.93 ± 2.27** (p < 0.001)

65.05 ± 1.72 ** (p = 0.008)

Fibrillin 1

49.85 ± 0.26

51.84 ± 0.77** (p = 0.02)

54.97 ± 0.96** (p < 0.001)

C-Xyloside improves the deposition of extracellular matrix proteins in the superficial dermis

Deposition of extracellular matrix proteins such as pro-collagen 1 and fibrillin 1 was assessed by immunostaining on control and C-Xyloside treated reconstructed skins. In control samples, staining for procollagen 1 was weak, positive in the whole dermal equivalent with a slightly higher intensity in the upper part of the dermis. C-Xyloside treated samples showed an increase in the staining specifically localized underneath the epidermis (figure 3). The fibrillin 1 staining in control samples was almost negative. C-Xyloside-supplemented samples showed a higher staining intensity for fibrillin 1, with thin fibers especially localized in the upper part of the dermal equivalent (table 2, figure 3).

Discussion

In the present study, we investigated the effects of a new xylopyranoside derivative, C-Xyloside, on dermal epidermal junction proteins. The use of a reconstructed skin model allowed major DEJ proteins to be visualized and localized during its reconstruction, thus confirming that organotypical models including both the epidermis and living dermal fibroblasts represent suitable models for studying DEJ morphogenesis [19, 21, 30, 31]. We first showed that, when added during epidermal morphogenesis, C-Xyloside did not interfere with the normal epidermal differentiation programme. This suggests that such a sugar derivative is not responsible for cytotoxic or deleterious effects on normal human cells, even after an 11 day contact, which represents a relatively long treatment for an in vitro morphogenetic system.

Our data showed that C-Xyloside induced higher deposition of several basement membrane and upper dermis components involved in the correct architecture and function of DEJ. We observed i) an increase in the production of collagen IV, the major component of lamina densa, ii) a higher production of laminin 5, corresponding to anchoring microfilaments responsible for connections between hemidesmosomes and lamina densa, and iii) an increased amount of collagen VII corresponding to anchoring fibrils. A better collagen IV scaffold on the dermal substrate as well as higher amounts of laminin 5 strengthen the attachment of keratinocytes onto the basement membrane [32, 33]. An increased number of collagen VII microfibrils might enhance the dermal epidermal adherence [34]. These biological activities seem crucial regarding the role of the DEJ zone in skin cohesion and resistance to mechanical stress. Defects of functional laminin 5 or collagen VII lead to dramatic skin fragility and proneness to blistering, as illustrated in patients affected with epidermolysis bullosa [9]. In more physiological conditions, such as the ageing process, decreased collagen VII may be related to increased skin fragility [11]. Finally our study also revealed that extracellular matrix proteins such as pro-collagen I and fibrillin 1 which represent major dermal fibrillar components, were increased. These structural proteins are responsible for the firmness and elasticity of the papillary dermis in human skin It has also been shown that collagen VII interacts both with the basement membrane laminin 5 and collagen IV components and with the collagen I fibers [35, 36]. Taken together, these effects indicate a more mature DEJ after C-Xyloside treatment.

In a first attempt to understand the molecular mode of action of the xylose derivative, mRNA levels for collagen VII α1 and collagen IV α1 genes were measured in dermal fibroblasts and found to be upregulated after C-Xyloside treatment, suggesting a transcriptional regulation. It has been previously shown that the regulation of collagen genes mostly occurred at the transcriptional level [37]. However, further investigations have to be performed to better characterize the transcriptional regulation and eventually to identify the related responsive element(s). Previous studies have demonstrated that C-Xyloside increased GAG and HS-PG expression [23]. Through their ability to capture and store growth factors and cytokines [38, 39], they may indirectly be responsible for the up-regulation of collagen genes. The collagen VII gene was shown to be upregulated in dermal fibroblasts by several cytokines [40, 41]. Interactions between both compartments through the release of soluble factors have also been reported to influence the basement membrane zone [42]. It has also been shown that proteoglycans can modify the balance between proteases and antiproteases. The implications of such biological activity have been illustrated in wound fluids for syndecans, thus suggesting a role in the wound healing process [43]. However, we did not find any modulation in MMP-2 levels after C-Xyloside treatment (data not shown). In addition, direct interactions between GAGs/PGs and fibrillar matrix proteins were previously reported. Perlecan, a basement membrane HS-PG is able to bind and accelerate collagen fibril formation [44]. Perlecan can also bind to collagen IV, nidogen, laminin and fibronectin within the basement membrane as well as with collagen I [45, 46]. Syndecan, another HS-PG can directly bind to laminin 5 [47]. It has to be stressed that both of these HS-PGs are induced by C-Xyloside. Further analysis of levels of various cytokines, growth factors and MMPs may help in understanding the biological activities of C-Xyloside.

In conclusion, our findings indicate that, in addition to stimulating GAG and HS-PG synthesis, C-Xyloside increases the expression of collagen genes and deposition of key proteins involved in the functional DEJ, thus strongly suggesting beneficial effects on defective DEJ from restoring or improving its soundness and cohesion.

Acknowledgments

We would like to thank Dr G Meneguzzi for generous gift of the GB3 antibody. Financial support: none. Conflict of interest: none.

References

1 Kerscher M, Williams S, Dubertret L. Cosmetic dermatology and skin care. Eur J Dermatol 2007; 17: 180-2.

2 de Rigal J, Escoffier C, Querleux B, Faivre B, Agache P, Leveque JL. Assessment of aging of the human skin by in vivo ultrasonic imaging. J Invest Dermatol 1989; 93: 621-5.

3 Richard S, Querleux B, Bittoun J, Jolivet O, Idy-Peretti I, de Lacharriere O, Leveque JL. Characterization of the skin in vivo by high resolution magnetic resonance imaging: water behavior and age-related effects. J Invest Dermatol 1993; 100: 705-9.

4 Chung JH, Seo JY, Choi HR, Lee MK, Youn CS, Rhie G, Cho KH, Kim KH, Park KC, Eun HC. Modulation of skin collagen metabolism in aged and photoaged human skin in vivo. J Invest Dermatol 2001; 117: 1218-24.

5 Varani J, Dame MK, Rittie L, Fligiel SE, Kang S, Fisher GJ, Voorhees JJ. Decreased collagen production in chronologically aged skin: roles of age-dependent alteration in fibroblast function and defective mechanical stimulation. Am J Pathol 2006; 168: 1861-8.

6 Varani J, Warner RL, Gharaee-Kermani M, Phan SH, Kang S, Chung JH, Wang ZQ, Datta SC, Fisher GJ, Voorhees JJ. Vitamin A antagonizes decreased cell growth and elevated collagen-degrading matrix metalloproteinases and stimulates collagen accumulation in naturally aged human skin. J Invest Dermatol 2000; 114: 480-6.

7 Lavker RM. Cutaneous aging: chronologic versus photoaging. In: Gilchrest BA, ed. Photodamage. Cambridge USA: Blackwell Science Inc., 1995: 123-35.

8 Yaar M. Clinical and histological features of intrinsic versus extrinsic aging. In: B A Gilchrest JK, ed. Skin aging. 2006: 9-21; (Berlin).

9 Burgeson RE, Christiano AM. The dermal-epidermal junction. Curr Opin Cell Biol 1997; 9: 651-8.

10 Woodley DT, Chen M. The basement membrane zone. In: Freinkel RK, Woodley DT, eds. The Biology of the Skin. New York: The Parthenon Publishing Group, 2001: 133-52.

11 Craven NM, Watson RE, Jones CJ, Shuttleworth CA, Kielty CM, Griffiths CE. Clinical features of photodamaged human skin are associated with a reduction in collagen VII. Br J Dermatol 1997; 137: 344-50.

12 Contet-Audonneau JL, Jeanmaire C, Pauly G. A histological study of human wrinkle structures: comparison between sun-exposed areas of the face, with or without wrinkles, and sun-protected areas. Br J Dermatol 1999; 140: 1038-47.

13 Talwar HS, Griffiths CE, Fisher GJ, Hamilton TA, Voorhees JJ. Reduced type I and type III procollagens in photodamaged adult human skin. J Invest Dermatol 1995; 105: 285-90.

14 Watson RE, Griffiths CE, Craven NM, Shuttleworth CA, Kielty CM. Fibrillin-rich microfibrils are reduced in photoaged skin. Distribution at the dermal-epidermal junction. J Invest Dermatol 1999; 112: 782-7.

15 Finch PW, Rubin JS, Miki T, Ron D, Aaronson SA. Human KGF is FGF-related with properties of a paracrine effector of epithelial cell growth. Science 1989; 245: 752-5.

16 Hirai Y, Takebe K, Takashina M, Kobayashi S, Takeichi M. Epimorphin: a mesenchymal protein essential for epithelial morphogenesis. Cell 1992; 69: 471-81.

17 Lavker RM. Structural alterations in exposed and unexposed aged skin. J Invest Dermatol 1979; 73: 59-66.

18 Stoker AW, Streuli CH, Martins-Green M, Bissell MJ. Designer microenvironments for the analysis of cell and tissue function. Curr Opin Cell Biol 1990; 2: 864-74.

19 Fleischmajer R, MacDonald ED, Contard P, Perlish JS. Immunochemistry of a keratinocyte-fibroblast co-culture model for reconstruction of human skin. J Histochem Cytochem 1993; 41: 1359-66.

20 Marinkovich MP, Keene DR, Rimberg CS, Burgeson RE. Cellular origin of the dermal-epidermal basement membrane. Dev Dyn 1993; 197: 255-67.

21 Marionnet C, Pierrard C, Vioux-Chagnoleau C, Sok J, Asselineau D, Bernerd F. Interactions between fibroblasts and keratinocytes in morphogenesis of dermal epidermal junction in a model of reconstructed skin. J Invest Dermatol 2006; 126: 971-9.

22 Marionnet C, Vioux-Chagnoleau C, Pierrard C, Sok J, Asselineau D, Bernerd F. Morphogenesis of dermal-epidermal junction in a model of reconstructed skin: beneficial effects of vitamin C. Exp Dermatol 2006; 15: 625-33.

23 Pineau N, Bernerd F, Dalko-Csiba M, Breton L. A new C-xylopyranoside derivative induces skin expression of glucosaminoglycans and heparan sulphate proteoglycans. Eur J Dermatol 2008; 18(1): 36-40.

24 Maatta A, Jaakkola P, Jalkanen M. Extracellular matrix-dependent activation of syndecan-1 expression in keratinocyte growth factor-treated keratinocytes. J Biol Chem 1999; 274: 9891-8.

25 Kvist AJ, Johnson AE, Morgelin M, Gustafsson E, Bengtsson E, Lindblom K, Aszodi A, Fassler R, Sasaki T, Timpl R, Aspberg A. Chondroitin sulfate perlecan enhances collagen fibril formation. Implications for perlecan chondrodysplasias. J Biol Chem 2006; 281: 33127-39.

26 Rheinwald JG, Green H. Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinizing colonies from single cells. Cell 1975; 6: 331-43.

27 Asselineau D, Bernhard B, Bailly C, Darmon M. Epidermal morphogenesis and induction of the 67 kD keratin polypeptide by culture of human keratinocytes at the liquid-air interface. Exp Cell Res 1985; 159: 536-9.

28 Bernerd F, Vioux C, Asselineau D. Evaluation of the protective effect of sunscreens on in vitro reconstructed human skin exposed to UVB or UVA irradiation. Photochem Photobiol 2000; 71: 314-20.

29 Bernerd F, Asselineau D. Successive alteration and recovery of epidermal differentiation and morphogenesis after specific UVB-damages in skin reconstructed in vitro. Dev Biol 1997; 183: 123-38.

30 Boyce ST, Supp AP, Swope VB, Warden GD. Vitamin C regulates keratinocyte viability, epidermal barrier, and basement membrane in vitro, and reduces wound contraction after grafting of cultured skin substitutes. J Invest Dermatol 2002; 118: 565-72.

31 el Ghalbzouri A, Jonkman MF, Dijkman R, Ponec M. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes. J Invest Dermatol 2005; 124: 79-86.

32 Takeda A, Kadoya K, Shioya N, Uchinuma E, Tsunenaga M, Amano S, Nishiyama T, Burgeson RE. Pretreatment of human keratinocyte sheets with laminin 5 improves their grafting efficiency. J Invest Dermatol 1999; 113: 38-42.

33 Dawson RA, Goberdhan NJ, Freedlander E, MacNeil S. Influence of extracellular matrix proteins on human keratinocyte attachment, proliferation and transfer to a dermal wound model. Burns 1996; 22: 93-100.

34 Burgeson RE. Type VII collagen, anchoring fibrils, and epidermolysis bullosa. J Invest Dermatol 1993; 101: 252-5.

35 Chen M, Marinkovich MP, Veis A, Cai X, Rao CN, O’Toole EA, Woodley DT. Interactions of the amino-terminal noncollagenous (NC1) domain of type VII collagen with extracellular matrix components. A potential role in epidermal-dermal adherence in human skin. J Biol Chem 1997; 272: 14516-22.

36 Keene DR, Sakai LY, Lunstrum GP, Morris NP, Burgeson RE. Type VII collagen forms an extended network of anchoring fibrils. J Cell Biol 1987; 104: 611-21.

37 Bornstein P, Sage H. Regulation of collagen gene expression. Prog Nucleic Acid Res Mol Biol 1989; 37: 67-106.

38 Mongiat M, Otto J, Oldershaw R, Ferrer F, Sato JD, Iozzo RV. Fibroblast growth factor-binding protein is a novel partner for perlecan protein core. J Biol Chem 2001; 276: 10263-71.

39 Tkachenko E, Rhodes JM, Simons M. Syndecans: new kids on the signaling block. Circ Res 2005; 96: 488-500.

40 Mauviel A, Lapiere JC, Halcin C, Evans CH, Uitto J. Differential cytokine regulation of type I and type VII collagen gene expression in cultured human dermal fibroblasts. J Biol Chem 1994; 269: 25-8.

41 Vindevoghel L, Lechleider RJ, Kon A, de Caestecker MP, Uitto J, Roberts AB, Mauviel A. SMAD3/4-dependent transcriptional activation of the human type VII collagen gene (COL7A1) promoter by transforming growth factor beta. Proc Natl Acad Sci USA 1998; 95: 14769-74.

42 Pageon H, Bakala H, Monnier VM, Asselineau D. Collagen glycation triggers the formation of aged skin in vitro. Eur J Dermatol 2007; 17: 12-20.

43 Kainulainen V, Wang H, Schick C, Bernfield M. Syndecans, heparan sulfate proteoglycans, maintain the proteolytic balance of acute wound fluids. J Biol Chem 1998; 273: 11563-9.

44 Kvist AJ, Johnson AE, Morgelin M, Gustafsson E, Bengtsson E, Lindblom K, Aszodi A, Fassler R, Sasaki T, Timpl R, Aspberg A. Chondroitin sulfate perlecan enhances collagen fibril formation. Implications for perlecan chondrodysplasias. J Biol Chem 2006; 281: 33127-39.

45 Bengtsson E, Morgelin M, Sasaki T, Timpl R, Heinegard D, Aspberg A. The leucine-rich repeat protein PRELP binds perlecan and collagens and may function as a basement membrane anchor. J Biol Chem 2002; 277: 15061-8.

46 Timpl R. Macromolecular organization of basement membranes. Curr Opin Cell Biol 1996; 8: 618-24.

47 Okamoto O, Bachy S, Odenthal U, Bernaud J, Rigal D, Lortat-Jacob H, Smyth N, Rousselle P. Normal human keratinocytes bind to the alpha3LG4/5 domain of unprocessed laminin-5 through the receptor syndecan-1. J Biol Chem 2003; 278: 44168-77.


 

Qui sommes-nous ? - Contactez-nous - Conditions d'utilisation - Paiement sécurisé
Actualités - Les congrès
Copyright © 2007 John Libbey Eurotext - Tous droits réservés
[ Informations légales - Powered by Dolomède ]