Accueil > Revues > Médecine > European Journal of Dermatology > Texte intégral de l'article
 
      Recherche avancée    Panier    English version 
 
Nouveautés
Catalogue/Recherche
Collections
Toutes les revues
Médecine
European Journal of Dermatology
- Numéro en cours
- Archives
- S'abonner
- Commander un       numéro
- Plus d'infos
Biologie et recherche
Santé publique
Agronomie et Biotech.
Mon compte
Mot de passe oublié ?
Activer mon compte
S'abonner
Licences IP
- Mode d'emploi
- Demande de devis
- Contrat de licence
Commander un numéro
Articles à la carte
Newsletters
Publier chez JLE
Revues
Ouvrages
Espace annonceurs
Droits étrangers
Diffuseurs



 

Texte intégral de l'article
 
  Version imprimable
  Version PDF

ARS Component B: structural characterization, tissue expression and regulation of the gene and protein (SLURP‐1) associated wi


European Journal of Dermatology. Volume 13, Numéro 6, 560-70, November - December 2003, Investigative report


Summary  

Auteur(s) : Renato MASTRANGELI, Silvia DONINI, Christie A. KELTON, Chaomei HE, Alessandro BRESSAN, Ferdinando MILAZZO, Veniero CIOLLI, Francesco BORRELLI, Fabrizio MARTELLI, Mauro BIFFONI, Ottaviano SERLUPI‐CRESCENZI, Serenella SERANI, Emilia MICANGELI, Nabil EL TAYAR, Rosa VACCARO, Tindaro RENDA, Romeo LISCIANI, Mara ROSSI, Ruben PAPOIAN , Industria Farmaceutica Serono S.p.A Ardea site, 00040, Rome, Italy Serono Reproductive Biology Institute, Rockland, MA 02370 USA Dipartimento di Anatomia Umana, Università « La Sapienza », 00161 Rome, Italy Istituto di Farmacologia e Farmacognosia, Università « La Sapienza », 00185 Rome, Italy .

Illustrations

ARTICLE

Auteur(s) : Renato MASTRANGELI1, Silvia DONINI1, Christie A. KELTON2, Chaomei HE2, Alessandro BRESSAN1, Ferdinando MILAZZO1, Veniero CIOLLI1, Francesco BORRELLI1, Fabrizio MARTELLI1, Mauro BIFFONI1, Ottaviano SERLUPI-CRESCENZI1, Serenella SERANI1, Emilia MICANGELI1, Nabil EL TAYAR2, Rosa VACCARO3, Tindaro RENDA3, Romeo LISCIANI4, Mara ROSSI1, Ruben PAPOIAN1

1 Industria Farmaceutica Serono S.p.A Ardea site, 00040, Rome, Italy
2 Serono Reproductive Biology Institute, Rockland, MA 02370 USA
3 Dipartimento di Anatomia Umana, Università « La Sapienza », 00161 Rome, Italy
4 Istituto di Farmacologia e Farmacognosia, Università « La Sapienza », 00185 Rome, Italy

Article accepted on 23/09/2003

Abbreviations: Ag, antigen; AP, adapter primer; ARS, Ares-Serono; ATRA, all trans retinoic acid; EGF, epidermal growth factor; GPI, glycosyl-phosphatidylinositol moiety; PBMC, peripheral blood mononuclear cells; PHA, phytohemagglutinin; SLURP-1, secreted Ly-6/uPAR related protein; SCC, squamous cell carcinoma; RACE, rapid amplification of cDNA ends; RIG-E, retinoic acid-inducible gene-E; RT, reverse transcription; TG1, transglutaminase 1; uPAR, urokinase-type plasminogen activator receptor

The protective function of the skin is the result of a regulated differentiation process that takes place in keratinocytes from the basal layer to the spinous, granular, transitional, and cornified layers, which together form a continuously renewing stratified squamous epithelium [1, 2]. Additional squamous stratified epithelia are present in tongue, esophagus, cervix, and cornea [3]. In the differentiation process specific keratinocyte markers are either induced or repressed [1]; calcium [4] and retinoic acid [5, 6] play a critical regulatory role in differentiation.
Mal de Meleda (MDM, OMIM number MIM 248300) is a rare skin disorder characterized by transgressive palmoplantar keratoderma, keratotic skin lesions, perioral erythema, brachydactyly and nail abnormalities. In this article we present the structural characterization, tissue expression and regulation of the human ARS Component B and murine ars component b genes. The ARS Component B gene has been implicated as the causative gene of Mal de Meleda [7-9]. Component B protein (now known as SLURP-1) was isolated during the extraction and purification process of human urinary proteins (Serono, unpublished data). Translation of the human gene sequence was totally consistent with the urinary protein sequence. The ARS Component B gene (EMBL AC: X99977) encodes a soluble protein [10] belonging to the Ly-6/CD59/uPAR/snake toxin superfamily (CD59: cell membrane inhibitor of the complement attack complex; uPAR: urokinase-type plasminogen activator receptor) [11-16]. Specifically, ARS Component B belongs to the Ly-6 subfamily. Here we present results on the characterization of the ARS Component B gene and its encoded protein SLURP-1. Both ARS Component B and its protein product SLURP-1 were found to be mainly localized in keratinocytes of squamous stratified epithelia. The results presented here and the association of Mal de Meleda with mutations in the ARS Component B gene on chromosome 8q24.3 [7-9] imply an important function of the ARS Component B gene and its secreted protein SLURP-1 [10] in maintaining the physiological and structural integrity of the keratinocyte layers of the skin.

Materials and methods

Cloning of Human ARS Component B Gene and cDNA. A 90 bp human genomic DNA fragment was amplified using guess-primers derived from the urinary protein N-terminal sequence: 5'-CTGAAGTGCTACACCTGTAAGGAGCCAATG; and 5'- GTGGTCATGCAGGCGGTGTCCTC). A human placental genomic DNA library in lambda phage vector EMBL-3 SP6/T7 (Clontech) was then screened with two horseradish peroxidase-conjugated oligonucleotides prepared following the Urdea procedure [17] and derived from the internal sequence of the 90 bp genomic fragment, i.e. CB1 (5'-TGCAGGAAGCACTGGTCAT) and CB2 (5'-TCTGGCTTGCAGCGGGTAATGGT). Hybridization was performed at 42°C for 45 min with 5 ng/ml of probe in 5 × SSC (0.15M sodium chloride, 0.015M sodium citrate), 0.02% SDS, 0.1% N-laurylsarcosine, and 0.5% blocking reagent (Boehringer-Mannheim). Filters were washed twice at 42°C for 15 min with 3 × SSC, 0.1% SDS, and 18% or 27% urea for probes CB1 and CB2, respectively. Hybridizing plaques were visualized by enhanced chemiluminescent reagents (ECL, Amersham, UK).
To assess the expression pattern of the ARS Component B gene, samples of total RNA from various tissues were subjected to reverse transcription (RT)-PCR with exon 2-derived primers CKCB1 (5'-TCAAGTGCTACACCTGCAAGGAG) and CKCB2 (5'-ACCGTCACCAGCGTGGTC). Uterus polyA+ RNA (Clontech) was used to obtain the 5' and 3' ends of the ARS Component B cDNA using a rapid amplification of cDNA ends (RACE) kit (Invitrogen), according to the protocol supplied by the manufacturer. CKCB1 was used as the gene specific primer for 3' RACE. The gene specific primers for 5' RACE were CKCB2 and 5'-CGTCAGAGAGGAGGTG. PCR amplifications were done using a Touchdown' PCR temperature cycling program [18]. The 450 and 230 bp fragments obtained by 3' and 5' RACE PCR, respectively, were cloned into the EcoRV site of pBluescriptSK + T-vector' (Stratagene). An expression construct containing the complete protein coding region of SLURP-1 was assembled from the 5' and 3' RACE clones using routine cloning methods. Most of the 3' untranslated region, including the poly(A) tail, was removed from the expression construct by truncating at the BanI site downstream of the stop codon. The cDNA encoding the full-length SLURP-1 protein was then subcloned into the expression vector pDα and stably transfected into Chinese hamster ovary cells using methods previously described [19].
Cloning of murine ars component b. A mouse BALB/c genomic DNA library in lambda phage vector EMBL-3 SP6/T7 (Clontech) was screened with a single-stranded 32P-labeled human ARS Component B exon 3 probe following standard procedures. Positive plaques were revealed by filter exposure to Hyperfilm- b max (Amersham).
Automated DNA synthesis and sequencing. Oligonucleotides were synthesized with a 392 DNA synthesizer (Applied Biosystem). Cycle-sequencing reactions were run on the automated 373A DNA sequencer (Applied Biosystem) following the manufacturer's instructions.
Cells and culture conditions. PBMCs were obtained from buffy coats of blood donation units and cultured as described [20]. Granulocytes were separated from red cells by centrifugation on 63% Percoll. Buffy coats were kindly provided by the Blood Bank of the Ospedale Civile di Marino (Italy). Human umbilical vein endothelial cells were isolated as described [21] and cultured in Medium 199 supplemented with 0.9 g/l NaHCO3, 50 µg/ml endothelial cell growth factor (Collaborative Biomedical Products), 100 µg/ml heparin, 20% FCS, 2 mM L-glutamine, and antibiotics at 37°C and 5% CO2. Human foreskin fibroblasts were kindly provided by Inter Pharm Laboratories (Ness Ziona, Israel) and routinely cultured in DMEM supplemented with 10% FCS, 2 mM L-glutamine, and antibiotics at 37°C and 8% CO2. Human endometrial adenocarcinoma HEC-1-A, endometrial metastatic adenocarcinoma AN-3-CA, uterine leiomyosarcoma SK-UT-1 and SK-UT-1B, hepatocellular carcinoma HepG2, lung carcinoma A549, epidermoid carcinoma A431, and squamous cell carcinoma SCC4, SCC9, and SCC25 cells were purchased from the American Type Culture Collection (Rockville, MD). SK-UT-1, SK-UT-1B, AN-3-CA, and HepG2 cells were cultured in Eagle's MEM (Gibco) supplemented with non-essential amino acids, 1 mM sodium pyruvate, Earle's balanced salt solution, 10% FCS, 2 mM L-glutamine, and antibiotics at 37°C and 5% CO2. HEC-1-A cells were cultured in McCoy's 5a medium (Gibco), supplemented with 10% FCS, 2 mM L-glutamine, and antibiotics at 37°C and 5% CO2 A431 cells were cultured in DMEM with 4.5 g/l glucose (Gibco), supplemented with 10% FCS, 2 mM L-glutamine, and antibiotics at 37°C and 5% CO2. A549 cells were cultured in nutrient mixture Ham's F12 medium (Gibco), supplemented with 10% FCS, 2 mM L-glutamine, and antibiotics at 37°C and 5% CO2.. SCC-4, SCC-9, and SCC-25 cells were maintained in a 1:1 mixture of Ham's F12 medium and DMEM supplemented with 10% FCS and antibiotics. Human skin keratinocytes were kindly provided by M. De Luca (IDI Research Institute, Pomezia, Italy) or purchased from Clonetics. The keratinocytes were cultured in keratinocyte basal medium (Clonetics) supplemented with 0.1 ng/ml human epidermal growth factor (EGF), 5 µg/ml insulin, 0.5 µg/ml hydrocortisone, 30 µg/ml bovine brain extract, and antibiotics at 37°C and 5% CO2.
Cell treatments for ARS component B mRNA expression analysis. ARS component B mRNA expression was investigated in human foreskin fibroblasts after 24 h of incubation in culture medium at 37°C and 8% CO2 Granulocytes were stored overnight at 4°C in RPMI-1640 before analysis. PBMCs were cultured for 72 h at 37°C with 1 µg/ml phytohemagglutinin (PHA-HA16, Murex Diagnostics) and 100 ΙU/ml IL-2 (Eurocetus) or RPMI + FCS as control. Subconfluent keratinocytes were incubated for 96 h with basal medium containing 0.05 or 1 mM Ca2 + , 0.1 or 10 ng/ml EGF, and with or without 1000 U/ml IFN-γ (Genzyme) or 10 µM All-trans retinoic acid (Sigma Chemical Co.) at 37°C and 5% CO2 SCC subconfluent monolayers were cultured for 20 h with serum-free culture medium at 37°C and 5% CO2.
RT-PCR and Northern Blotting of ARS component B. Total RNA was extracted from homogenized organs/tissues or cells by TRIzol reagent (Invitrogen). Human samples included lung, uterus (exocervix), skin, granulocytes, and PBMCs. Mouse samples included liver, spleen, muscle, kidney, brain, uterus, intestine, heart, lung, trachea, esophagus, ovary, testis, bone marrow, thymus, bladder, aorta, eye, submaxillary gland, stomach, and skin. Human RNA master blot (# 7770-1, Clontech), containing spots of poly A+RNAs from different tissues and relevant controls, was used to assess human tissue distribution by filter hybridization with a 32P-labeled probe.
For RT-PCR experiments, 5 µg of total RNA were reverse transcribed using SuperScript II reverse transcriptase (Invitrogen) and random primers [22] in 50 µl total volume. DNA contamination was assessed by treating RNA as above but without adding reverse transcriptase. Alternatively, RNA was treated with RNase-free DNase before cDNA synthesis. For PCR, 1/5 of the resulting ± RT reaction was amplified with 50 pmoles primer pair in 100 µl total volume.
Human ARS component B cDNA was amplified (27 cycles at 94°C × 30 s, 63°C × 20 s, 72°C × 90 s) using platinum Taq DNA polymerase (Invitrogen) and primers CBF4 (5'-CGGAATTCTGGCCTCTCGCTGGGCTGTG) and CBR3 (5'-CATCCATGGCGGCCCCGATGCTGTC), which give a 278 bp fragment. Mouse ars component b was amplified (two cycles at 97°C × 30 s, 54°C × 30 s, 72°C × 3 min, and 25 cycles at 97°C × 30 s, 65°C × 30 s, 72°C × 3 min) using Pfu DNA polymerase (Stratagene) and primers mCBF (5'-GGAATTCCTGACCCTTCGCTGGGCCATGT) and mCBR (5'-GGAACGATCGGGCCCTGCCGGGAGAGT), which give a 402 bp fragment. Human β -actin was amplified (27 cycles at 95°C × 30 s, 67°C × 30 s, 72°C × 3 min) using platinum Taq DNA polymerase and primers BAL (5'-GGCCAGAGGCGTACAGGGATAGCAC) and BAU (5'-GGCGACGAGGCCCAGAGCAAGAGAG), which give a 277 bp fragment. Murine β-actin was amplified (27 cycles at 95°C × 30 s, 60°C × 30 s, 72°C × 3 min) using Pfu DNA polymerase and BAU/BAL primers, which give a 277 bp fragment. Human G3PDH was amplified (27 cycles at 94°C × 2 min, 65°C × 45 s, 72°C × 4 min) using Pfu DNA polymerase and primers G3PDHF (5'-TGCTGAT GCCCCCATGTTCGT) and G3PDHR (5'-GGCAATGCCAGCCCCAGCGTCAA), which give a 532 bp fragment. Human transglutaminase 1 (TG1) was amplified (27 cycles at 94°C × 2 min, 63°C × 5 s, 72°C × 4 min) using Pfu DNA polymerase and primers TG1U (5'-TATGGCCAGTGCTGGG TCTTTG) and TG1L (5'-ATCCTGCCGCTGCCAGTACA), which give a 408 bp fragment.
For northern blot analysis, 20 µg aliquots of total RNA were fractionated by denaturing agarose gel electrophoresis and blotted onto a nylon membrane (Hybond N+, Amersham). Human RNA blots were hybridized with 2 × 106 cpm/ml of a 32P-labeled probe prepared by asymmetric PCR using primer CBR3 and a pre-amplified 278 bp ARS component B cDNA fragment as template. Murine RNA blots were hybridized with 32P-labelled probe similarly synthesized with a murine 402 bp Ars component b cDNA fragment. Hybridization and detection were performed following standard procedures. Northern blots were re-hybridized with 28S rRNA horseradish peroxidase-conjugated oligonucleotide and detected by ECL reagent in order to estimate RNA degradation.
ELISA for SLURP-1. Polyclonal Abs were prepared by immunizing rabbits with purified urinary SLURP-1 protein. IgG were affinity-purified on Protein G-Sepharose (Pharmacia Biotech). For the “capture Ab” microtiter plates were coated with anti-SLURP-1 polyclonal Abs. For the “detecting Ab” biotinylated anti-SLURP-1 polyclonal were used. Purified SLURP-1 was used to construct the standard curve for the ELISA. Plates were developed with Extravidin-AP (Sigma Chemical Co.) and enzyme substrate (Fast pNPP tablets, Sigma Chemical Co.). Plates were read at 405 nm.
Western Blot analysis. Supernatants from human skin keratinocytes and control cultures were concentrated and the total protein content was determined using Coomassie Plus Protein assay reagent (Pierce). The proteins (100 µg/lane) were size-fractionated on a reducing, 15%, SDS-PAGE, and transferred to nitrocellulose filters by electroelution. SLURP-1 protein was detected with rabbit anti-SLURP-1 and goat anti-rabbit–horseradish peroxidase Abs. The reaction was developed with ECL reagents (Amersham).
Immunohistochemistry. Human uterus and vagina specimens were obtained from women undergoing surgery. Epithelial cells from exocervical mucosa were obtained from women undergoing PAP tests at different phases of the menstrual cycle and in the post-menopausal period. Breast, lung, skin (breast trunk, abdomen and limbs), and gum specimens were obtained after partial surgical removal of related organs. Esophageal epithelium was obtained from biopsy specimens.
All tissue samples were fixed by immersion in cold buffered picric acid-paraformaldehyde (PAF) fixative mixture for 24-48 h [23]. Tissue samples were divided into small specimens that were processed in two different ways: (a) embedded in synthetic paraffin wax and cut into serial 10-µm thick sections, which were collected on albumin-coated slides; or (b) cryoprotected with 15% sucrose in 0.1 M phosphate buffer at pH 7.3, frozen and cut into serial 20-µm thick sections, which were either mounted on chrome alum/gelatin-coated slides or treated as free-floating sections. Uterine exocervical smears were treated as frozen sections. To block endogenous peroxidase, dewaxed and frozen sections were pretreated with 0.1 M phosphate buffered saline (PBS), pH 7.3, containing 0.1% sodium azide and 0.3% H2O2 (24). Some sections were submitted to digestion with 1 U/ml papain (Sigma Chemical Co.) for 10 min at 37°C. The digestion was stopped by dipping the sections into 4% paraformaldehyde in PBS for 30 min at room temperature. Sections were incubated overnight at room temperature, or for 48 h at 4°C, using polyclonal Abs to SLURP-1 diluted 1:25,000-1:100,000 in PBS containing 0.1% BSA (type VI, Sigma Chemical Co.) (PBS/BSA). The immune reaction was revealed by the ABC method (Vectastain Elite kit, Vector Laboratories), incubating for 2 h at room temperature with biotinylated goat anti-rabbit IgG diluted 1:1,000 with PBS/BSA, and for 1 h at room temperature with streptavidin–biotin–peroxidase complex diluted 1:2,000. The peroxidase activity was then visualized by using a 3-min reaction with a mixture containing 0.04% 3-3' diaminobenzidine tetrahydrochloride (Fluka), 0.4% nickel ammonium sulfate, and 0.003% H2O2 in 0.05 M Tris-HCl buffer, pH 7.6. The specificity of immunohistochemical reactions was shown by the lack of staining when the primary Ab was replaced with PBS or pre-immune rabbit IgG, and when it was pre-incubated with an excess of SLURP-1 protein (50 µg/ml).

Results

Cloning of human ARS component B cDNA.
To select an appropriate source of RNA for cDNA cloning, the expression of human ARS component B was investigated by RT-PCR in various human tissues including brain, liver, skeletal muscle, spleen, thymus, kidney, heart, lung, pancreas, placenta, uterus, testis, and salivary gland. Primers were derived from the preliminary genomic DNA sequence of exon 2 (see below). Uterus mRNA was found to be highly positive for ARS component B (data not shown), and was therefore used for cDNA isolation by 5' and 3' RACE. Four of five 5' RACE clones started at the same site ATCACTTCTG, while one clone had an extra CTCTC. The longest 5' RACE transcript was considered for the definition of the transcription start site in the European Molecular Biology Laboratory submission (Fig. 1A).
Analysis of the precursor SLURP-1 amino acid sequence for the eukaryotic signal peptide cleavage site by the SignalP method [25] predicted a primary cleavage site between Ala 22 and Leu 23. This is consistent with the N-terminus determined by amino acid sequencing of the urinary protein. Two additional putative signal peptide cleavage sites could be predicted. However, upon expression in transfected Chinese hamster ovary cells mature SLURP-1 protein displayed the same N-terminus as the urinary protein (data not shown). This confirmed that mature human SLURP-1 is a protein 81 amino acids in length and that the precursor protein has an additional 22 amino acid secretory signal peptide at the N-terminus.

Isolation and characterization of a human ARS component B genomic clone.
A 90 bp genomic fragment was amplified with primers derived from the N-terminal sequence of the human SLURP-1 protein (data not shown). The internal sequence of this fragment was used to design hybridization probes for isolating the full-length ARS component B gene.
The ARS component B gene contained three exons flanked by appropriate consensus acceptor and donor splice sites (Fig. 1A). Sequence analysis of the 551 bp promoter region upstream of the transcription start site revealed a TATA box and binding sites for several transcription factors, including AP1, AP2, and Sp1. Binding sites identical to those present within promoters of involucrin (AP1 and AP2) and TG1 (AP2-like) are indicated in Fig. 1A [26]. The sequence GGCTGCAGGCCAGGCTGCAGGG close to a Sp1 site contains a central AP2 sequence (AGGCCAG) overlapping a tandem repeat of the known KER-1 binding site [2], GGCTGCAGGC and GGCTGCAGGG, spaced by two nucleotides (Fig. 1A). These KER-1 sites are 90% and 80% conserved, respectively, compared with the consensus palindromic KER-1 binding site. They showed 100% and 90% identity, respectively, with the sequence present in the cytokeratin K1 promoter [3]. An additional region of 11 bp in the ARS component B promoter (the 353-364 site AGGTGATGCAAGC in Fig. 1A) showed high homology with a keratinocyte-specific cis element found in the gene for human desmoglein 3 [27].

Cloning of the murine ars component b gene.
The murine ars component b gene was cloned from a mouse genomic DNA library by conventional screening with a DNA probe derived from human ARS component B exon 3. The murine ars component b cDNA was then cloned by RT-PCR from whole lung. The cDNA sequence was found to be identical to that obtained from genomic exons. Murine ars component b had the same gene structure as the human counterpart (Fig. 1B). The overall homology of the human and murine coding regions was 78%. The predicted murine ars component b encoded protein is preceded by a putative 22 amino acid signal peptide (SignalP prediction method). The mature murine protein is 88 amino acids in length (Fig. 2).
Analysis of the promoter region (nucleotides 1-633) showed the presence of TATA boxes and putative binding sites for several transcription factors. The eukaryotic promoter prediction by neural network [28] predicted additional promoter elements for RNA polymerase II (Fig. 1B).

SLURP-1 protein sequence analysis.
Human and murine SLURP-1 share 68% amino acid identity (Fig. 2). All the structurally important cysteine residues and most prolines and hydrophobic residues are well conserved, predicting a similar folding pattern. Blast search of SLURP-1 against the Swissprot/Trembl databases showed similarity with the Ly-6/CD59/uPAR/snake toxin family members [11, 29]. Although the overall sequence homology is relatively low (24-32%), SLURP-1 shares some features with the Ly-6/CD59 family members, including 10 similarly spaced cysteines, an N-terminal LXCYXC motif, and the conserved C-terminal consensus sequence CCXXDLCN [11]. Ly-6 is an emerging protein family comprising a domain with a common three-dimensional structure and a similar structural gene organization [12, 14]. The human members of this family include retinoic acid-inducible gene-E [30, 31], E48 [32, 33] and prostate stem cell [34] Ags. This family is also structurally related to CD59 [35], snake venom neurotoxin [11], multiple domains of uPAR [14], and rodent bone gene RoBo-1 [36] (Fig. 2).
Based on the amino acid sequence of human and murine SLURP-1 and the known three-dimensional structure of the homologous soluble CD59, the C α atoms of the residues from the SLURP-1 sequence in the regions of high homology were superimposed on the template structure of CD59. The atomic coordinates for soluble CD59 were obtained from Brookhaven Protein Database. Molecular modeling, based on the three-dimensional structure by nuclear magnetic resonance imaging of CD59 and cobra neurotoxin [37], suggested that SLURP-1 may be a dipolar molecule with a three-finger structure and five disulfide bridges at positions C3-C28, C6-C15, C21-C51, C55-C71, and C72-C77, respectively (Fig. 3).

Human ARS component B/ SLURP-1 tissue distribution, RNA expression, and regulation.
Immunohistochemistry with rabbit polyclonal antibodies (Abs) detected positive cells within the intermediate (spinous and granular) layers of squamous stratified epithelium of human skin, mucosa of exocervix, vagina and gingiva (Fig. 4) as well as in the esophageal epithelium (data not shown). The SLURP-1 positive cells displayed a flattened shape and the immunopositive material filled their cytoplasm. In human skin, the granular cell layer keratinocytes were found to be the most positive cells among all the tested human tissue specimens (Fig. 4a). All analyzed skin samples showed a similar staining pattern. Pre-incubation of the antiserum with SLURP-1 resulted in no staining (Fig. 4b), demonstrating the specificity of the antiserum and immunohistochemical labelling. SLURP-1 immunoreactivity was not found in breast, lung, skeletal muscle, and non-squamous epithelia. Circulating SLURP-1 was detected by ELISA in human plasma. The mean value (± SD) of SLURP-1 plasma concentration (as determined in 56 healthy individuals) was 12.68 ng/ml (± 5.49), ranging from 6.26 to 34.49 ng/ml. SLURP-1 was also found in human urine (data not shown).
RT-PCR and northern blotting analysis showed ARS component B RNA expression in human tissues such as skin, trachea, whole uterus, and uterine exocervix, and in cultured keratinocytes, but not in lung or any other cultured primary cell type analyzed, such as human umbilical vein endothelial cells, foreskin fibroblasts, PBMCs, and granulocytes (Fig. 5A, Fig. 6, and data not shown). These results confirm overall previously reported data [7]. In cultured keratinocytes, the signal detected by RT-PCR almost disappeared when the cells were treated with IFN-γ, EGF or ATRA (Fig. 6A, lanes 2, 3, 5, 6; and Fig. 6B, lane 1). Treatment of these cells with 1 mM calcium (known to induce keratinocyte differentiation) [2, 4] resulted in the partial reversal of the downregulating effects of EGF (Fig. 6B, lane 1 vs lane 2). In the conditions used, we failed to detect superinduction of the basal level of keratinocyte ARS component B RNA expression by high calcium concentration (Fig. 6A, lanes 1 vs lane 4). Cultured keratinocytes were also shown to express the TG1 differentiation marker in all conditions tested (low/high calcium, ± IFN-γ and ± ATRA) (Fig. 6A). SLURP-1 protein was shown by Western blotting to be secreted in vitro by human keratinocytes with an apparent molecular weight of 9 kD (Fig. 7), similar to the urinary and recombinant proteins, and consistent with the molecular weight predicted from the unglycosylated amino acid sequence.
Various human cell lines derived from tumor of the uterus (HEC-1-A, SK-UT-1, SK-UT-1B, and AN-3-CA), liver (HepG2), lung (A549), and epidermis (A431) were analyzed for ARS component B expression by RT-PCR. None of these cells expressed ARS component B RNA except for the differentiated keratinocyte-like A431 epidermoid carcinoma cell line (data not shown).
The observed expression pattern led us to a further analysis of ARS component B RNA expression in additional human tumor keratinocyte cell lines SCC-4, SCC-9, and SCC-25. The SCC-4 cell line represents an early keratinocyte differentiation stage [38], while SCC-9 and SCC-25 represent intermediate-to-late stages of differentiation [39]. Expression of ARS component B RNA by RT-PCR was found in SCC-9 and in SCC-25 cells, but not in the early-stage SCC-4 cells (Fig. 8). The late keratinocyte differentiation marker TG1 was expressed only in SCC-25 cells and not in SCC-4 and SCC-9 cells. Overall, these results and the immunohistochemistry data suggested that ARS component B gene and SLURP-1 expression might be associated with the mid-to-late differentiation stages of human keratinocytes.
Expression of murine ars component b was also investigated by RT-PCR in several murine organs. The highest expression was found in the eye. The lung, stomach, trachea, and esophagus were also positive. A low ars component b expression was observed in the heart and thymus, while lower or undetectable levels were observed in the brain, intestine, liver, spleen, bone marrow, kidney, uterus, aorta, skeletal muscle, ovary, testis, bladder, and submaxillary glands (data not shown). Northern blot analysis confirmed high ars component b expression in mouse eye and skin, while positive signals were observed in lung and stomach (Fig. 5B).

Discussion

This paper describes the cloning, gene structure, tissue distribution, regulation, and the plasma levels of SLURP-1, a novel member of the Ly-6/uPAR superfamily [12-14]. This emerging protein family includes the Ly-6 T-cell Ags located on chromosome 15 in the mouse [12], while in humans most of the genes in the family are located on the syntenic region of chromosome 8 [30]. Human ARS component B has been mapped to the distal portion of the long arm of chromosome 8 (Hs. 103505, NCBI UniGene, ref. 8). The human family includes the prostate stem cell Ag that is overexpressed in prostate carcinoma [34], the E48 Ag [32], the RIG-E Ag [31], the CD59 Ag [40], and GML, a gene induced by p53 [41]. The Ly-6 family is characterized by the presence of 10 cysteines forming five disulfide bridges, a similar genomic structure [14, 42], and a similar modeled three-dimensional protein structure [43]. Interestingly, most genes of the Ly-6 Ag family consist of four exons, the first one being untranslated, and are expressed on lymphocytes and other cell types. An exception is the human E48 Ag gene which consists of three exons and is expressed only in keratinocytes of stratified squamous epithelia and in squamous cell carcinoma [33]. It has been suggested that the functional elimination of an ancestral Ly-6 untranslated exon 1 switched the expression from lymphocytes towards keratinocytes [33]. The human ARS component B gene displays an exon/intron organization similar to that of the E48 gene. Like E48, ARS component B mRNA is expressed in keratinocytes. This evidence supports the hypothesis of an evolutionary divergence of tissue specific regulation of gene expression, co-evolving from local chromosomal duplication events [10].
The uPAR [42], snake venom neurotoxin [11], and RoBo-1 [36] molecules are also structurally related to the Ly-6 family. It has been suggested that the Ly-6/CD59/uPAR/snake venom toxin proteins were derived from a common ancestral gene, thus forming a gene superfamily [10, 11]. Although the members of this family have different biological activities, most of them are anchored to the cell membrane by a glycosyl-phosphatidylinositol moiety (GPI) [12, 13]. All known GPI-anchored proteins are synthesized with a 10-20 residue hydrophobic domain at the C-terminus that is cleaved before GPI addition [44]. Just upstream to the proposed GPI anchor site, the CCXXDLCN octapeptide is conserved in most Ly-6 family members [11]. This motif is also present in human and murine ARS Component B genes. However, the C-terminal hydrophobic stretch is not present in the human SLURP-1 protein, which is therefore secreted into the culture medium of keratinocytes, as shown by Western blot analysis, and is also detectable as a soluble protein in human urine and plasma (see Results and ref. 10).
In both human and murine ARS component B gene promoters we have observed the presence of several putative transcription factor binding sites, including AP1, AP2, and Sp1. These transcription factors are known to be involved in the differentiation of human epidermis [2, 26]. Human ARS component B showed putative AP1, AP2, and AP2-like binding sites identical to those found in the involucrin and TG1 promoters [26]. Interestingly, the involucrin AP2 site as with ARS component B AP2 site, is overlapped with two putative KER-1 binding sequences. In the keratin-14 promoter, this sequence interacts with the KER-1 nuclear factor to contribute to an optimal tissue-specific promoter activity [2, 3]. Also, the human cytokeratin K1 promoter showed a KER-1 binding site that competed for KER-1 binding [3]. Cytokeratin K1, involucrin, and TG1 are differentiation markers expressed in the suprabasal layers of the epidermis. An additional sequence in the human ARS component B promoter shares high homology with the internal region of the keratinocyte-specific cis element that contributes to epidermal–specific expression of the gene encoding human desmoglein 3 [27]. The presence of several putative regulatory sequences, known to be active in specific and localized epidermal tissue, suggests a highly regulated expression of ARS component B. This is restricted to suprabasal layers of epidermis and other squamous stratified epithelia of various organs, as confirmed by immunohistochemistry, RT-PCR, and northern blotting analyses. The apparent differences in the tissue/organ distribution of SLURP-1 between mouse and man could be due to differences in the cell compositions of the tested tissue samples. As ARS component B expression appears to be higher in cells of squamous stratified epithelia, it is possible that the mouse uterine tissue contained too little exocervix to give a detectable signal. In regards to the lung, neither human nor mouse samples contained squamous epithelial tissue. However, mouse samples included large bronchi that were histologically similar to trachea, whereas the human sample was restricted to the pulmonary surface. A truly different tissue distribution of ARS component B and SLURP-1 between human and mouse cannot, however, be ruled out. As discussed above, this latter conclusion is supported by the observation that human E48 showed a different tissue expression with respect to its murine counterparts (THB) [33]. Indeed, human E48 is expressed in keratinocytes (as is human ARS component B) and murine THB is expressed additionally in lymphoid cells [33].
After screening various normal and tumoral human cells cultured in vitro, expression of ARS component B mRNA was found in keratinocytes, in the two squamous cell carcinoma cell lines, representing later stages of differentiation [39] and in the differentiated keratinocyte-like epidermoid cell line A431 [45], while it was not expressed in a non-differentiated keratinocyte cell line [38]. In these cells, ARS component B RNA had an expression pattern similar to that of the TG1 gene [2, 38].
A high concentration of extracellular calcium is known to induce keratinocyte differentiation [1, 4, 46]. In addition, in the complex environment of differentiating keratinocytes, a gradient of increasing calcium concentration is associated with cell differentiation towards the external layers of the epidermis [2, 4], while EGF is known to play an active role in basal cell proliferation [2, 39, 47, 48]. Our results in cultured keratinocytes appear to be well framed in this context, consistently showing an upregulation of ARS component B RNA expression by high extracellular calcium, but only in the presence of EGF. In cultured keratinocytes, we also observed a clear downregulation of ARS component B mRNA expression by retinoic acid. This pattern would support the hypothesis that ARS component B is expressed from cells undergoing squamous differentiation, as retinoic acid was shown to suppress the expression of squamous-specific genes in cultured keratinocytes [49]. However, IFN-γ, which is an inducer of keratinocyte differentiation [49], also downmodulated ARS component B expression. This suggests that not all the pathways inducing squamous cell differentiation trigger ARS component B expression.
It is worth noting that the ARS component B gene has been mapped to the distal portion of the long arm of chromosome 8 (Hs. 103505, NCBI UniGene), in the same region as the genes for the E48 [32], RIG-E [31], PSCA [34] and GML [41]. Recently, a new human Ly-6 gene family member has been isolated (LY6H: accession number NP—002338) and is localized on chromosome 8q24.3 [50] in the same region of ARS component B. It may play a role in both the central nervous system and the immune system. Chromosome 15 in mouse, which is syntenic to human chromosome 8 where ARS component B has been mapped, is strongly associated with the wound-healing process [51].
Preliminary studies to elucidate SLURP-1 cell target(s) and its mechanism of action did not support SLURP-1 as a growth factor for human foreskin fibroblasts, endothelial cells, keratinocytes, and tumor cells of various origins (data not shown). However, it has been observed that, in addition to its barrier function between organism and environment, the epidermis may be considered a secretory tissue whose expressed proteins might have local growth, metabolic, and immunologic functions as well as systemic effects [52]. SLURP-1 is readily detectable in human serum and urine [here and 10], and may be considered one more example of an epidermal secreted molecule whose biological function certainly needs further investigation.
There have been a number of recent reports attributing the recessive skin disorder Mal de Meleda to mutations in the ARS component B gene [7-9]. However, there is one report that describes a patient with Mal de Meleda that does not show such a mutation [53]. This may indicate that other genes in the 8q24.3 cluster might also lead to skin disorders involving hyperproliferation of keratinocytes. A recent report [54] identified another new member of the Ly-6 family, SLURP-2, which is upregulated in psoriasis vulgaris. This new member of the Ly-6 family is flanked by ARS component B and E48 [53]. This cluster of ARS component B, SLURP-2 and E48 may play an essential role in regulation of keratinocyte physiology. Dysfunction of these genes either alone or in concert might lead to different skin disorders characterized by keratinocyte hyperproliferation, such as Mal de Meleda and other palmoplantar keratodermas. Overall, the results presented here and the association of Mal de Meleda with the ARS component B gene imply an important function of the secreted protein product SLURP-1 in maintaining the physiological and structural integrity of the keratinocyte layers of the skin. n

Acknowledgements. The authors are grateful to Carlo Cafiero for his efficient statistical assistance, Michele De Luca for providing human keratinocytes, Eva De Luca for providing the SLURP-1 amino acid sequence data used for the isolation of the human gene, Roberta Bucci for the excellent ELISA work and Christopher Hebert with generous help in the preparation of the figures.

References

1. Dlugosz AA, Yuspa SH. Coordinate changes in gene expression which mark the spinous to granular cell transition in epidermis are regulated by protein kinase C. J Cell Biol 1993; 120: 217-25.

2. Eckert RL, Welter JF. Epidermal keratinocytes - genes and their regulation. Cell Death Differ 1996; 3: 373-83.

3. Leask A, Rosenberg M, Vassar R, Fuchs E. Regulation of a human epidermal keratin gene: sequences and nuclear factors involved in keratinocyte-specific transcription. Genes Develop 1990; 4: 1985-98.

4. Filvaroff E, Calautti E, Reiss M, Dotto GP. Functional evidence for an extracellular calcium receptor mechanism triggering tyrosine kinase activation associated with mouse keratinocyte differentiation. J Biol Chem 1994; 269: 21735-40.

5. Fuchs E, Green H. Regulation of terminal differentiation of cultured human keratinocytes by vitamin A. Cell 1981; 25: 617-25.

6. Darmon M, and M. Blumenberg M. Retinoic acid in epithelial and epidermal differentiation. In: Darmon M, Blumenberg M, eds. Molecular Biology of the Skin. New York: Academic Press, 1993: 181-206.

7. Fischer J, Bouadjar B, Heilig R, Huber M, Lefevre C, Jobard F, Macari F, Bakija-Konsuo A, Alt-Belkacem F, Weissenbach J, Lathrop M, Hohl D, Prud'homme JF. Mutations in the gene encoding SLUPR-1 in Mal de Meleda. Hum Mol Genet 2001; 10: 875-80.

8. Ward KM, Yerebakan O, Yilmaz E, Celebi JT. Identification of recurrent mutations in the ARS (Component B) gene encoding SLURP-1 in two families with Mal de Meleda. J Invest Dermatol 2003; 120: 96-8.

9. Eckl KM, Stevens HP, Lestrignant GG, Westenberger-Treuman M, Traupe H, Hinz B, Frossard P.M, Stadler R, Leigh IM, Nurnberg P, Reis A, Hennies HC. Mal de Meleda (MDM) caused by mutations in the gene for SLURP-1 in patients from Germany, Turkey, Palestine, and the United Arab Emirates. Hum Genet 2003; 112: 50-6.

10. Adermann K, Wattler F, Wattler S, Heine G, Meyer M, Forssmann W, Nehls, M. Structural and phylogenetic characterization of SLURP-1, the first secreted mammalian member of the Ly6/uPAR protein family. Protein Sci 1999; 8: 810-9.

11. Fleming TJ, O'hUigin C, Malek TR. Characterization of two novel Ly-6 genes. Protein sequence and potential structural similarity to alpha-bungarotoxin and other neurotoxins. J Immunol 1993; 150: 5379-90.

12. Gumley TP, McKenzie IF, Sandrin MS. Tissue expression, structure and function of the murine Ly-6 family of molecules. Immunol Cell Biol 1995; 73: 277-96.

13. Palfree RG. Ly-6-domain proteins — new insights and new members: a C-terminal Ly-6 domain in sperm acrosomal protein SP-10. Tissue Antigens 1996; 48: 71-9.

14. Ploug,M, Ellis V. Structure–function relationships in the receptor for urokinase-type plasminogen activator. Comparison to other members of the Ly-6 family and snake venom alpha-neurotoxins. FEBS Lett 1994; 349: 163-8.

15. Rees B, Bilwes A. Three-dimensional structures of neurotoxins and cardiotoxins Chem Res Toxicol 1993; 6: 385-406 [published erratum appears in Chem Res Toxicol 1993; 6: 912.

16. Shan XC, Bourdeau A, Rhoton A, Wells DE, Cohen EH, Landgraf BE, Palfree RGE. Characterization and mapping to human chromosome 8Q24.3 of LY-6-related gene 9804 encoding an apparent homologue of mouse TSA-1. J Immunol 1998; 160: 197-208.

17. Urdea MS, Warner BD, Running JA, Stempien M, Clyne J, Horn T. A comparison of non-radioisotopic hybridization assay methods using fluorescent, chemiluminescent and enzyme labeled synthetic oligodeoxyribonucleotide probes. Nucl Acids Res 1988; 16: 4937-56.

18. Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS. Touchdown' PCR to circumvent spurious priming during gene amplification. Nucl Acids Res 1991; 19: 4008.

19. Kelton, CA, Cheng SVY, Nugent NP, Schweickhardt RL, Rosenthal JL, Overton SA, Wands GD, Kuzeja JB, Luchette CA, Chappel SC. The cloning of the human follicle stimulating hormone receptor and its expression in COS-7, CHO, and Y-1 cells. Mol Cell Endocrinol 1992; 89: 141-51.

20. Biffoni M, Marcucci I, Ythier A, Eshkol A. Effects of urinary gonadotrophin preparations on human in-vitro immune function. Hum Reprod 1998; 13: 2430-4.

21. Jaffe EA, Mosher DF. Synthesis of fibronectin by cultured human endothelial cells. J Exp Med 1978; 147: 1779-91.

22. Gram H, Marconi LA, Barbas CF, Collet TA, Lerner RA, Kang AS. In vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library. Proc Natl Acad Sci USA. 1992; 89: 3576-80.

23. Stefanini M, Demartino C, Zamboni L. Fixation of ejaculated spermatozoa for electron microscopy. Nature 1967; 216: 173-4.

24. Li CY, Ziesmer SC, Lazcano-Villareal O. Use of azide and hydrogen peroxide as an inhibitor for endogenous peroxidase in the immunoperoxidase method. J Histochem Cytochem 1987; 35: 1457-60.

25. Nielsen H, Engelbrecht J, Brunak S, Vonheijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 1997; 10: 1-6.

26. Eckert RL, Crish JF, Banks EB, Welter JF. The epidermis — genes on — genes off. J Invest Dermatol 1997; 109: 501-9.

27. Silos SA, Tamai K, Li K, Kivirikko S, Kouba D, Christiano AM, Uitto J. Cloning of the gene for human pemphigus vulgaris antigen (desmoglein 3), a desmosomal cadherin. Characterization of the promoter region and identification of a keratinocyte-specific cis-element. J Biol Chem 1996; 271: 17504-11.

28. Reese MG, Harris NL. Eeckman FH. Large scale sequencing specific neural networks for promoter and splice site recognition. In: Hunter L, Klein TE, eds. Biocomputing: Proceedings of the 1996 Pacific Symposium. Singapore: World Scientific Publishing Co. Singapore 1996: (Abstr).

29. MacNeil I, Kennedy J, Godfrey DI, Jenkins NA, Masciantonio M, Mineo C, Gilbert DJ, Copeland NG, Boyd RL, Zlotnik A. Isolation of a cDNA encoding thymic shared antigen-1. A new member of the Ly6 family with a possible role in T cell development. J Immunol 1993; 151: 6913-23.

30. Capone MC, Gorman DM, Ching EP, Zlotnik A. Identification through bioinformatics of cDNAs encoding human thymic shared Ag-1/stem cell Ag-2. A new member of the human Ly-6 family. J Immunol 1996; 157: 969-73.

31. Mao M, Yu M, Tong JH, Ye J, Zhu J, Huang QH, Fu G, Yu L, Zhao SY, Waxman S, Lanotte M, Wang ZY, Tan JZ, Chan SJ, Chen Z. RIG-E, a human homolog of the murine Ly-6 family, is induced by retinoic acid during the differentiation of acute promyelocytic leukemia cell. Proc Natl Acad Sci USA 1996; 93: 5910-4.

32. Brakenhoff R H, Gerretsen M, Knippels EM, van Dijk M, van Essen H, Weghuis DO, Sinke RJ, Snow GB, and van Dongen GA. The human E48 antigen, highly homologous to the murine Ly-6 antigen ThB, is a GPI-anchored molecule apparently involved in keratinocyte cell–cell adhesion. J Cell Biol 1995; 129: 1677-89.

33. Brakenhoff RH, van Dijk M, Rood-Knippels EMC, Snow GB. Gain of novel tissue specificity in the human LY-6 gene E48. J Immunol 1997; 159: 4879-86.

34. Reiter RE, Gu ZN, Watabe T, Thomas G, Szigeti K, Davis E, Wahl M, Nisitani S, Yamashiro J, Lebeau MM, Loda M, Witte ON. Prostate stem cell antigen — a cell surface marker overexpressed in prostate cancer. Proc Natl Acad Sci USA 1998; 95: 1735-40.

35. Petranka JG, Fleenor DE, Sykes K, Kaufman RE, Rosse WF. Structure of the CD59-encoding gene: further evidence of a relationship to murine lymphocyte antigen Ly-6 protein. Proc Natl Acad Sci USA 1992; 89: 7876-9 [published erratum appears in Proc Natl Acad Sci USA 1993; 90: 5878].

36. Noel LS, Champion BR, Holley CL, Simmons CJ, Morris DC, Payne JA, Lean JM, Chambers TJ, Zaman G, Lanyon LE, Suva LJ, Miller LR. ROBO-1, a novel member of the urokinase plasminogen activator receptor/CD59/LY-6/snake toxin family selectively expressed in rat bone and growth plate cartilage. J Biol Chem 1998; 273: 3878-83.

37. Fletcher CM, Harrison RA, Lachmann PJ, Neuhaus D. Sequence-specific 1H-NMR assignments and folding topology of human CD59. Protein Sci 1993; 2: 2015-27.

38. Duvic M, Nelson DC, Annarella M, Cho M, Esgleyes-Ribot T, Remenyik E, Ulmer R, Rapini RP, Sacks PG, Clayman GL, Davies PJL Thacher S. Keratinocyte transglutaminase expression varies in squamous cell carcinomas. J Invest Dermatol 1994; 102: 462-9.

39. Monzon RI, McWilliams N, Hudson LG. Suppression of cornified envelope formation and type 1 transglutaminase by epidermal growth factor in neoplastic keratinocytes. Endocrinology 1996; 137: 1727-34.

40. Forsberg UH, Bazil V, Stefanova I, Schroder J. Gene for human CD59 (likely Ly-6 homologue) is located on the short arm of chromosome 11. Immunogenetics 1989; 30: 188-93.

41. Furuhata T, Tokino T, Urano T, Nakamura Y. Isolation of a novel GPI-anchored gene specifically regulated by p53; correlation between its expression and anti-cancer drug sensitivity. Oncogene 1996; 13: 1965-70.

42. Casey JR, Petranka JG, Kottra J, Fleenor DE, Rosse WF. The structure of the urokinase-type plasminogen activator receptor gene. Blood 1994; 84: 1151-6.

43. Fletcher CM, Harrison RA, Lachmann PJ, Neuhaus D. Structure of a soluble, glycosylated form of the human complement regulatory protein CD59. Structure 1994; 2: 185-99.

44. Thomas JR, Dwek RA, Rademacher TW. Structure, biosynthesis, and function of glycosylphosphatidylinositols. Biochemistry 1990; 29: 5413-22.

45. Mils V, Piette J, Barette C, Veyrune JL, Tesniere A, Escot C, Guilhou JJ, Basset-Seguin N. The proto-oncogene c-fos increases the sensitivity of keratinocytes to apoptosis. Oncogene 1997; 14: 1555-61.

46. Maruoka Y, Harada H, Mitsuyasu T, Seta Y, Kurokawa H, Kajiyama M, Toyoshima K. Keratinocytes become terminally differentiated in a process involving programmed cell death. Biochem Biophys Res Commun 1997; 238: 886-90.

47. Hatta N, Takata M, Kawara S, Hirone T, Takehara K. Tape stripping induces marked epidermal proliferation and altered TGF-alpha expression in non-lesional psoriatic skin. J Dermatol Sci 1997; 14: 154-61.

48. Jiang CK, Magnaldo T, Ohtsuki M, Freedberg IM, Bernerd F, Blumenberg M. Epidermal growth factor and transforming growth factor alpha specifically induce the activation — and hyperproliferation — associated keratins 6 and 16. Proc Natl Acad Sci USA 1993; 90: 6786-90.

49. Saunders NA, Jetten AM. Control of growth regulatory and differentiation-specific genes in human epidermal keratinocytes by interferon gamma. Antagonism by retinoic acid and transforming growth factor beta 1. J Biol Chem 1994; 269: 2016-22.

50. Horie M, Okutomi K, Taniguchi Y, Ohbuchi Y, Suzuki M, Takahashi E. Isolation and characterization of a new member of the human Ly6 family (LY6H). Genomics 1998; 53: 365-8.

51. McBrearty BA, Clark LD, Zhang XM, Blankenhorn EP, Heber-Katze E. Genetic analysis of a mammalian wound-healing trait. Proc Natl Acad Sci USA 1998; 95: 11792-7.

52. Katz AB, Taichman LB. Epidermis as a secretory tissue: an in vitro tissue model to study keratinocyte secretion. J Invest Dermatol 1994; 102: 55-60.

53. van Steensel MAM, van Geel M, Steijlen PM. Mal de Meleda without mutations in the ARS coding sequence. Eur J Dermatol 2003; 12: 129-32.

54. Tsuji H, Okamota K, Matsuzaka Y, Iizuka H, Tamiya G, Inoko H. SLURP-2, a novel member of the human Ly-6 superfamily that is up-regulated in psoriasis vulgaris. Genomics 2003; 81: 26-33.


 

Qui sommes-nous ? - Contactez-nous - Conditions d'utilisation - Paiement sécurisé
Actualités - Les congrès
Copyright © 2007 John Libbey Eurotext - Tous droits réservés
[ Informations légales - Powered by Dolomède ]