Accueil > Revues > Médecine > European Journal of Dermatology > Texte intégral de l'article
 
      Recherche avancée    Panier    English version 
 
Nouveautés
Catalogue/Recherche
Collections
Toutes les revues
Médecine
European Journal of Dermatology
- Numéro en cours
- Archives
- S'abonner
- Commander un       numéro
- Plus d'infos
Biologie et recherche
Santé publique
Agronomie et Biotech.
Mon compte
Mot de passe oublié ?
Activer mon compte
S'abonner
Licences IP
- Mode d'emploi
- Demande de devis
- Contrat de licence
Commander un numéro
Articles à la carte
Newsletters
Publier chez JLE
Revues
Ouvrages
Espace annonceurs
Droits étrangers
Diffuseurs



 

Texte intégral de l'article
 
  Version imprimable

Detection of cutaneous varicella zoster virus infections by immunofluorescence versus PCR


European Journal of Dermatology. Volume 11, Numéro 2, 108-11, March - April 2001, Revues


Summary  

Auteur(s) : Guntram D. BEZOLD, Monika E. LANGE, Helmut GALL, Ralf U. PETER, Department of Dermatology, University of Ulm, Oberer Eselsberg 40, 89081 Ulm, Germany..

Illustrations

ARTICLE

Detection of localized, clinically atypical cutaneous infections with varicella zoster virus (VZV) has proven difficult, as serum antibody tests are sometimes not suitable for that purpose. Direct identification of the virus can be done with cell culture, which is rather time-consuming, electron microscopy, or antigen detection, quite often based on immunofluorescence techniques [1-7]. Reported sensitivities of different techniques vary widely. In addition, amplification of DNA from skin swabs by polymerase chain reaction (PCR) has also been established [6-10]. However, due to its labor-intensity, PCR is still a comparatively time-consuming and therefore expensive method, even if established in a routine manner. The purpose of this study was to compare detection of VZV from skin swabs by PCR versus immunofluorescence in zoster patients diagnosed clinically, with respect to sensitivity and applicability in routine diagnostics.

Materials and methods

Patients

Cutaneous swabs were taken from lesions of patients visiting the Department of Dermatology, University of Ulm, Germany, for suspicion of varicella zoster or herpes simplex virus infections. The lesions the swabs were taken from consisted of erythema, blisters, pustules or crusts.

Immunofluorescence (direct immunofluorescent antibody test)

Thorough swabs were taken from the cutaneous lesions, fixed on a glass slide with acetone for 5 min and washed 5 min with phosphate buffered saline solution pH 7.2 (PBS). Then the specimen was overlaid with an anti-VZV mouse antibody (ade labware, Munich, Germany) diluted 1:40 with PBS and incubated in a moist chamber at room temperature for 20 min. Cross-reactivity of the anti-VZV antibody with herpes simplex virus types 1 and 2, cytomegalovirus and Epstein-Barr virus had been excluded by the manufacturer. After washing with PBS for 5 min the specimen was overlaid with a FITC-labeled anti-mouse antibody from rabbit diluted 1:30 with PBS/10% rabbit serum (ade labware) and incubated at room temperature for 20 min in a moist chamber. After washing with PBS for 5 min the moist specimen was investigated under a fluorescence microscope.

Criteria for investigation

A specimen was considered positive if fluorescence was detectable in three or more cells. Fluorescence was detectable either on the cell margin or throughout the whole cell surface (Fig. 1).

Specimens for PCR

Dry skin swabs were taken from the same location as for immunofluorescence and at the same time. They were thoroughly rinsed with 400 mul of sterile distilled water, and from 200 mul of this solution DNA was extracted.

DNA-extraction and PCR

DNA was extracted from 200 mul of the swab solution using the Quiagen blood kit (Quiagen, Hilden, Germany) following the manufacturer's protocol.

PCR was performed as described [11] in a GeneAmp 9700 thermocycler (Applied Biosystems, Weiterstadt, Germany). The final PCR-mixture contained MgCl2 2.5 mM, TRIS 10 mM, KCl 50 mM, 0.5 muM of each primer, 200 muM each of dATP, dTTP, dGTP and dCTP, and Taq polymerase (Boehringer Mannheim, Penzberg, Germany) 25 mU/mul. The downstream-primer was 5'-labeled with digoxigenin. Each PCR-tube contained 500 molecules of internal controls (= mimics) per 40 mul, consisting of the identical primer sequences as the target, but of a different intermediate sequence. PCR consisted of a first heating step (95° C for 5 min), 42 amplification cycles (95° C for 15 seconds, 60° C for 30 seconds, 72° C for 30 seconds) and one final extension step (72° C for 7.7 min). Primer sequences were ATGTCCGTACAACATCAACT (upstream) and CGATTTTCCAAGAGAGACGC (downstream) for VZV [12], and GAAGAGCCAAGGACAGGTAC (upstream) and CAACTTCATCCACGTTCACC (downstream) for beta-globin [13]. Fragment lengths were 267 bp for VZV and 546 bp for the VZV-mimic, and 268 bp for beta-globin and 546 bp for the beta-globin-mimic.

Construction and stabilization of internal controls (mimics)

DNA-mimics were constructed using the PCR MIMIC Construction Kit (Clontech, Palo Alto, CA, USA) following the manufacturer's protocol. These mimic fragments were stabilized by cloning them into a plasmid using the T/A Cloning Kit from Invitrogen (San Diego, CA, USA) following the manufacturer's protocol. Plasmid DNA was extracted using the High Pure Plasmid Isolation Kit (Boehringer Mannheim, Penzberg, Germany) and quantified by reading the optical density (OD) at 260 nm. The molar concentration was calculated, and the mimics were appropriately diluted.

PCR ELISA

This assay was performed using the principle of a commercially available system (PCR ELISA, Boehringer) following the manufacturer's protocol. In brief, two parts of 10 mul each of the respective PCR product were denatured with 10 mul alkaline solution ("denaturation solution") for 10 min at room temperature and hybridized with 0.75 pmol of a 5'-biotinylated oligonucleotide specific for the target (VZV or beta-globin) or the mimic, respectively, in a total volume of 120 mul. Of this mixture 100 mul were incubated in a streptavidin-coated microtiterplate at 55° C for one hour, washed five times (washing buffer included in the kit), incubated with 100 mul of a peroxidase-conjugated anti-digoxigenin antibody at 37° C for 30 min, washed five times and incubated with 100 mul of the substrate for peroxidase, 3,3'-5,5'-tetramethylbenzidine (TMB), at room temperature for 15 min. Then the reaction was stopped by adding 100 mul of 2 M hydrochloric acid, and the optical density was measured at a wavelength of 450 nm.

Sequences of the 5'-biotinylated oligoprobes were GGTGGAGACGACTTCAATAGC (VZV), ACACAACTGTGTTCACTAGC (beta-globin), and CAAGTTTCGTGAGCTGATTG (mimic).

Agarose gel electrophoresis

If detection by ELISA was positive the respective products of VZV-PCR were separated on a 2% agarose gel containing 0.5 mug/ml ethidium bromide and visualized under UV-light.

Criteria for PCR analysis

A sample was considered positive if color development was visible in the target ELISA (optical density > 0.1).

A sample was considered negative if no color developed in the target ELISA and if the mimic ELISA and beta-globin-ELISA were positive.

Optical densities of the negative control always were below 0.1.

Results

A total of 84 consecutive patients presenting with cutaneous lesions suggesting viral infection were routinely investigated for the presence of VZV both by immunofluorescence and PCR. An example for immunofluorescence is given in Figure 1. Detection of PCR-products was done primarily by ELISA, which is much more sensitive than agarose gel electrophoresis. Only ELISA-positive PCR-products were further separated on an agarose gel. Of these 84 samples three samples were positive by immunofluorescence and negative by PCR. However, in these samples PCR for herpes simplex virus (HSV) was performed additionally (data not shown), and all of them were positive for HSV. Clinical diagnoses were bullous drug reaction, herpes simplex recidivans in loco and acute postoperative infection with HSV, infection with VZV had not been suspected at all. For these reasons the most likely explanation for these discrepant results is a mistake in the laboratory, probably during immunofluorescence. These samples were excluded from the analysis. Four additional patients had herpes simplex virus infections clinically. In these patients immunofluorescence was positive for HSV and negative for VZV (data not shown). Therefore false-positive results due to unspecific cell fluorescence is highly unlikely.

In an additional five samples neither VZV-DNA nor beta-globin-DNA could be detected. Thus correctness of DNA extraction can not be proven, and these samples were also excluded.

Of the remaining 76 samples, 51 were positive by PCR; 43 were PCR-positive both by ELISA and agarose gel (84%), and 8 were PCR-positive only by ELISA (16%). Using immunofluorescence only 34 positive samples were found (67%). Every sample positive by immunofluorescence was also PCR-positive, and no specimen was positive by immunofluorescence and false-negative by PCR.

One inherent problem of immunofluorescence was the absence of cells or a low number of cells present on the slide. In routine diagnostics these specimens were counted as negative with the remark "no cells present" or "few cells present". The correct interpretation would have been "no analysis possible due to lack of material". When excluding these specimens from the analysis 60 samples remain. Of these 44 were PCR-positive by ELISA (44 = 100%). Of these ELISA-positive specimens 37 (84%) were also positive by agarose gel, and 34 (77%) were positive by immunofluorescence. Of the 37 samples PCR-positive both by ELISA and agarose gel 5 were negative for beta- globin (14%) whereas of the 7 samples PCR-positive only by ELISA, 4 were beta-globin-negative (57%). Results are summarized in Table I.

However, when only the results of the easy-to-perform agarose gel electrophoresis were considered, 29 samples were positive both by PCR and immunofluorescence, 8 samples only by PCR, and 5 samples only by immunofluorescence. Two samples PCR-positive by ELISA were missed by agarose gel and immunofluorescence.

Discussion

In the present study immunofluorescence was compared with PCR (detection of PCR products by ELISA and, if positive, by agarose gel in parallel) for detection of cutaneous VZV-infections. Immunofluorescence is a fast and comparatively inexpensive method and is, among others, used for detection of cutaneous VZV infections. Its reported sensitivity varies between 80% and 100% and is far better than cell culture or antibody assays [1-4, 6]. Up to now immunofluorescence and PCR have only been compared for laboratory diagnosis of zoster using vesicle specimens [6]. Also PCR products can be detected by different methods. An easy-to-perform and fast, but not very sensitive method is agarose gel electrophoresis. Sensitivity of detection can be improved by hybridization with radioactive probes or by using an ELISA method, with the sensitivity reaching a few or even single pre-PCR copies. This high sensitivity is especially important in patients presenting with initial or clinically abortive manifestations of VZV infection, such as segmental erythema without blisters, as the viral amount on such lesions has to be considered very low. However, this high sensitivity is associated with the danger of detecting clinically irrelevant colonization. Also criteria for correct interpretation of PCR results have to be observed. Apart from correct negative and positive controls the presence of amplifiable DNA should be proven. This can easily be done by detecting a human house-keeping gene, for example beta-globin. However, in the absence of beta-globin-DNA amplification of VZV from skin swabs is possible, as 9 of the 44 samples positive for VZV were negative for beta-globin. This discrepancy most likely is due to the absence or small amount of human DNA in the skin swabs, as the cells of the stratum corneum do not contain DNA any more. Also the correct amplification procedure should be proven for every individual PCR tube as PCR inhibition may occur [14, 15]. This can easily be accomplished with internal controls. Internal controls, or mimics, contain the same primer sequences as the target, but a different intermediate sequence and can thus be differentiated from the target [16]. Due to the identical primer sequences, mimic and target are competitively amplified [16]. Therefore mimics can be used as individual positive controls for every PCR-tube. This PCR system based on competitive amplification of internal controls and detection by a hybridization-based method complies with the Recommendations for Employing Molecular Methods in Diagnostic Routine Microbiology Laboratories and Measures for Internal Quality Assurance [17] of the German Society for Hygiene and Microbiology on technical PCR performance. Using this control system a positive sample has to show a positive signal in the detection system, and a negative sample has to have a negative signal with the internal controls and beta-globin being positive.

In 16 of 76 samples there were no or only a few cells present for immunofluorescence analysis, so no clear statement can be made, although these samples had been termed negative in the routine laboratory. Of the remaining 60 specimens 44 were PCR-positive by ELISA and 37 by agarose gel, and 34 by immunofluorescence. No sample was positive by immunofluorescence and negative by PCR. As it is impossible to determine which clinical specimen is really positive for VZV the total number of samples VZV-positive by PCR or immunofluorescence (44 specimens) was set as 100% [2]. With this reference, sensitivity of PCR with ELISA detection was 100% (44 of 44), of PCR with agarose gel detection 84% (37 of 44), and of immunofluorescence 77% (34 of 44). Of the 37 specimens PCR-positive by ELISA and agarose gel, 5 were negative for beta-globin (14%), whereas of the 7 samples PCR-positive only by ELISA, 4 were negative for beta-globin (57%). All these 7 patients had been diagnosed clinically as zoster. Most likely this high percentage of beta-globin-negative samples associated with low VZV detection is due to the low amount of starting material, especially in zoster patients presenting with erythema, but without blisters, erosions or crusts. Of the cases positive by PCR and negative by immunofluorescence one had been clinically diagnosed as varicella, and all others as zoster.

These results demonstrate that immunofluorescence is a fast, comparatively inexpensive and quite sensitive method for confirmation of cutaneous VZV infections. Results can be obtained after 1 hr. If care is taken that enough cells are present for analysis a sensitivity of 77% can be achieved. Therefore immunofluorescence can be used as a fast screening method. If immunofluorescence is negative, but zoster is clinically assumed, diagnostic accuracy can be augmented with PCR which takes longer to perform rendering it quite expensive. Also conventional agarose gel electrophoresis will not detect all VZV-positive samples, and detection of PCR products with ELISA is a very time-consuming procedure taking at least 8 hrs to perform.

CONCLUSION

In conclusion, immunofluorescence is a sufficiently sensitive method for detection of cutaneous VZV infections. Sensitivity can be improved by screening specimens negative by immunofluorescence with the more time-consuming and cost-intensive PCR.

REFERENCES

1. Dahl H, Marcoccia J, Linde A. Antigen detection: the method of choice in comparison with virus isolation and serology for laboratory diagnosis of herpes zoster in human immunodeficiency virus-infected patients. J Clin Microbiol 1997; 35: 347-9.

2. Coffin SE, Hodinka RL. Utility of direct immunofluorescence and virus culture for detection of varicella-zoster virus in skin lesions. J Clin Microbiol 1995; 33: 2792-5.

3. Zirn JR, Tompkins SD, Huie C, Shea CR. Rapid detection and distinction of cutaneous herpesvirus infections by direct immunofluorescence. J Am Acad Dermatol 1995; 33: 724-8.

4. Brumback BG, Farthing PG, Castellino SN. Simultaneous detection of and differentiation between herpes simplex and varicella-zoster viruses with two fluorescent probes in the same test system. J Clin Microbiol 1993; 31: 3260-3.

5. Perez JL, Garcia A, Niubo J, Salva J, Podzamczer D, Martin R. Comparison of techniques and evaluation of three commercial monoclonal antibodies for laboratory diagnosis of varicella-zoster virus in mucocutaneous specimens. J Clin Microbiol 1994; 32: 1610-3.

6. Sauerbrei A, Eichhorn U, Schacke M, Wutzler P. Laboratory diagnosis of herpes zoster. J Clin Virol 1999; 14: 31-6.

7. Beards G, Graham C, Pillay D. Investigation of vesicular rashes for HSV and VZV by PCR. J Med Virol 1998; 54: 155-7.

8. Rübben A, Baron JM, Grussendorf-Conen EI. Routine detection of herpes simplex virus and varicella zoster virus by polymerase chain reaction reveals that initial herpes zoster is frequently misdiagnosed as herpes simplex. Br J Dermatol 1997; 137: 259-61.

9. Jacobs JJ, Folkers E, Vreeswijk J. Detection of varicella-zoster virus and herpes simplex virus by the polymerase chain reaction with degenerate primers. J Virol Methods 1999; 83: 155-67.

10. Nahass GT, Mandel MJ, Cook S, Fan W, Leonardi CL. Detection of herpes simplex and varicella-zoster infection from cutaneous lesions in different clinical stages with the polymerase chain reaction. J Am Acad Dermatol 1995; 32: 730-3.

11. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA. Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988; 239: 487-91.

12. Puchhammer-Stöckl E, Popow-Kraupp T, Heinz FX, Mandl CW, Kunz C. Detection of varicella-zoster virus DNA by polymerase chain reaction in the cerebrospinal fluid of patients suffering from neurological complications associated with chicken pox or herpes zoster. J Clin Microbiol 1991; 29: 1513-6.

13. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 1985; 230: 1350-4.

14. Cone RW, Hobson AC, Huang MLW. Coamplified positive control detects inhibition of polymerase chain reaction. J Clin Microbiol 1992; 30: 3185-9.

15. Verkooyen RP, Luijendijk A, Huisman WM, Goessens WHF, Kluytmans JAJW, van Rijsoort-Vos JH, Verbrugh HA. Detection of PCR inhibitors in cervical specimens by using the AMPLICOR chlamydia trachomatis assay. J Clin Microbiol 1996; 34: 3072-4.

16. Siebert PD, Larrick JW. Competitive PCR. Nature 1992; 359: 557-8.

17. Roth A, Mauch H, Göbel U. Quality standards for microbiological diagnostic techniques for infectious disesases. Nucleic acid amplification techniques. Gustav Fischer Stuttgart, Jena, Lübeck, Ulm, 1997.


 

Qui sommes-nous ? - Contactez-nous - Conditions d'utilisation - Paiement sécurisé
Actualités - Les congrès
Copyright © 2007 John Libbey Eurotext - Tous droits réservés
[ Informations légales - Powered by Dolomède ]