Accueil > Revues > Médecine > Bulletin du cancer > Texte intégral de l'article
 
      Recherche avancée    Panier    English version 
 
Nouveautés
Catalogue/Recherche
Collections
Toutes les revues
Médecine
Bulletin du Cancer
- Numéro en cours
- Archives
- S'abonner
- Commander un       numéro
- Plus d'infos
Biologie et recherche
Santé publique
Agronomie et Biotech.
Mon compte
Mot de passe oublié ?
Activer mon compte
S'abonner
Licences IP
- Mode d'emploi
- Demande de devis
- Contrat de licence
Commander un numéro
Articles à la carte
Newsletters
Publier chez JLE
Revues
Ouvrages
Espace annonceurs
Droits étrangers
Diffuseurs



 

Texte intégral de l'article
 
  Version imprimable
  Version PDF

Étude moléculaire du rétinoblastome dans la population algérienne. Recherche de mutations du gène Rb au niveau constitutionnel et tumoral


Bulletin du Cancer. Volume 99, Numéro 2, 127-35, Février 2012, Article original

DOI : 10.1684/bdc.2011.1529

Résumé   Summary  

Auteur(s) : Amina Boubekeur, Lotfi Louhibi, Khadidja Mahmoudi, Abdallah Boudjema, Nadhira Mehtar, Université des sciences et de la technologie d’Oran USTO MB, département de génétique moléculaire appliquée, laboratoire de génétique moléculaire et cellulaire, Oran, Algérie, Établissement hospitalier spécialisé « Canastel », service d’ophtalmologie pédiatrique, Oran, Algérie.

Résumé : Une mutation des deux allèles du gène Rb, durant le développement rétinien normal, est responsable de l’apparition du rétinoblastome. La recherche de mutation au niveau du gène Rb reste difficile, car la majorité des altérations sont uniques et dispersées tout au long du gène. Nous rapportons dans notre étude le résultat de l’analyse du gène Rb au niveau constitutionnel et tumoral dans la population algérienne. Notre étude a porté sur un échantillon de 21 patients atteints de rétinoblastome. Le promoteur et les 27 exons, avec leurs séquences introniques flanquantes composant le gène Rb, ont été amplifiés et analysés par chromatographie liquide à haute performance (HPLC) suivie d’un séquençage. Les variations de bases identifiées au niveau constitutionnel et tumoral sont au nombre de sept : trois mutations non sens, une mutation affectant le site d’épissage, une délétion et deux polymorphismes. L’analyse du gène Rb a été réalisée chez des enfants atteints de rétinoblastome ne présentant aucun antécédent familial de la maladie. Par cette étude, nous avons pu identifier deux cas sur les 21 étudiés ayant un rétinoblastome pouvant être transmissible. Deux mutations rapportées n’ont jamais été décrites par la littérature.

Mots-clés : rétinoblastome, tumeur, gène Rb, mutation, HPLC, PCR-séquençage, diagnostic moléculaire

Illustrations

ARTICLE

bdc.2011.1529

Auteur(s) : Amina Boubekeur1 amina.boubekeur@hotmail.fr, Lotfi Louhibi1, Khadidja Mahmoudi2, Abdallah Boudjema1, Nadhira Mehtar1

1 Université des sciences et de la technologie d’Oran USTO MB, département de génétique moléculaire appliquée, laboratoire de génétique moléculaire et cellulaire, Oran, Algérie

2 Établissement hospitalier spécialisé « Canastel », service d’ophtalmologie pédiatrique, Oran, Algérie

Tirés à part : A. Boubekeur

Introduction

Le rétinoblastome est une tumeur maligne de la rétine, d’origine neuro-épithéliale. Son incidence est stable, décrite autour de 1/15 000 naissances en Algérie. Ce cancer affecte le nourrisson et le jeune enfant en général, avant l’âge de cinq ans [1]. On peut distinguer deux formes de rétinoblastome : la forme sporadique et la forme héréditaire. Les cas sporadiques sont toujours unilatéraux et représentent 60 % des patients, avec un âge médian au moment du diagnostic d’environ deux ans tandis que les formes héréditaires sont, pour la plupart, bilatérales. Ces dernières représentent 40 % des patients : 10 % sont transmises directement d’un parent affecté et 30 % semblent résulter d’une mutation de novo [2, 3], l’âge médian au moment du diagnostic est alors d’environ un an.

Sur un plan clinique, les principaux symptômes révélateurs sont une leucocorie (60,5 %) et un strabisme (21,5 %). La leucocorie (reflet blanc pupillaire « œil de chat ») correspond a la visualisation directe de la tumeur à travers l’aire pupillaire.

Le gène du rétinoblastome, gène Rb localisé sur le chromosome 13 en q14.2, exerce une fonction physiologique majeure de contrôle du cycle cellulaire. Il s’agit d’un gène suppresseur de tumeur. Pour ce type de gène, la transformation maligne d’une cellule rétinienne en cellule de rétinoblastome nécessite deux événements mutationnels affectant les deux allèles du gène RB1. Dans les formes héréditaires de rétinoblastomes, il existe une anomalie constitutionnelle du gène RB1. Le gène mutant serait soit hérité d’un parent, soit formé de novo durant la gamétogenèse d’un des parents. Il suffit qu’un second événement survienne au niveau du second allèle dans une cellule rétinienne pour qu’une tumeur se développe : c’est la raison pour laquelle les patients atteints de forme héréditaire de rétinoblastome ont très souvent des tumeurs bilatérales et multiples dans chaque œil. La transmission du risque de développer un rétinoblastome se fait selon le mode autosomique dominant avec une pénétrance élevée : 90 % des patients porteurs d’une anomalie constitutionnelle du gène RB1 développent un rétinoblastome [2]. Dans les formes sporadiques, les deux événements de mutation surviennent successivement sur chacun des deux allèles du gène RB1 au niveau d’une seule cellule de la rétine. Etant donné la faible probabilité d’un tel événement, sa survenue dans les deux yeux reste rarissime. C’est pourquoi, la forme sporadique est quasiment toujours unilatérale.

Le gène Rb code pour une protéine de 928 acides aminés, pRB. De nombreuses observations ont élucidé le rôle, qualifié d’anti-oncogène, de pRB dans une cellule normale. Elle permet la transduction des signaux extracellulaires provoquant l’arrêt de la multiplication cellulaire [4, 5]. Par un jeu de phosphorylations et déphosphorylations successives, elle joue ainsi un rôle important dans l’aptitude de la cellule à entrer dans la phase S, période pendant laquelle l’ADN est synthétisé [6]. Son absence explique que la croissance des cellules portant le gène muté n’est plus régulée et devient anarchique.

Notre étude s’est basée sur la recherche de mutation du gène Rb au niveau constitutionnel et tumoral chez des patients algériens atteints de rétinoblastome.

Dans le rétinoblastome comme dans la plupart des cancers, le pronostic dépend de la précocité du diagnostic. Ce diagnostic précoce, éventuellement prénatal, de la mutation permettra la prise en charge rapide de ces enfants par un suivi continu et contribuera ainsi à la prévention de la maladie.

Matériel et méthode

Notre étude a porté sur un total de 21 patients non apparentés, tous atteints de rétinoblastome de forme sporadique unilatérale ou bilatérale, désignés par la mention RUS pour les formes unilatérales sporadiques suivie d’un numéro. Seules six personnes ont pu être investiguées au niveau constitutionnel et tumoral, le reste des patients ont été analysés uniquement au niveau constitutionnel.

Le matériel biologique est constitué de 21 ADN génomiques extraits à partir du sang total et six ADN tumoraux prélevés à partir de tissus tumoraux des patients. Les prélèvements de sang ainsi que les tumeurs nous ont été fournis par le service d’ophtalmologie pédiatrique « hôpital pédiatrique de Canastel », Oran.

Le sang est prélevé, sur une solution d’EDTA 0,5 M. L’ADNg est extrait à partir du sang total selon la technique utilisant le NaCl [7] et l’ADN tumoral en utilisant du Trizol® prêt à l’emploi [8].

Vingt-sept couples d’amorces ont été utilisés pour l’amplification du promoteur et des 27 exons composant le gène Rb au niveau constitutionnel et tumoral (tableau 1). Les exons 15 et 16 sont amplifiés conjointement avec un couple d’amorce. Le choix des amorces a été fait dans les parties introniques flanquant chacun des exons de façon à couvrir, avec l’ensemble des amorces, la majeure partie du gène Rb.

Tableau 1 Liste et séquence des amorces utilisées pour l’amplification de l’ADN par PCR.

Exon/Intron Nom des amorces Séquence Taille des amplimères
(paires de bases)
Température d’hybridation des amorces (°C)
Promoteur SSR67
SSR68
CTGGACCCACGCCAGGTTTC
GTTTTGGGCGGCATGACGCCTT
259 62
Exon 1 SSR1
SSR2
CCGGTTTTTCTCAGGGGACGTTG
TTGCGCCCGCCCTACGCACAC
344 62
Exon 2 SSR3
SSR4
CTATTGAAACAAGTATGTACTG
GGGTAATGGAATTATTATTAGC
333 54
Exon 3 SSR5
SSR6
CAGTTTTAACATAGTATCCAG
AGCATTTCTCACTAATTCAC
281 55
Exon 4 SSR7
SSR8
GTAGTGATTTGATGTAGAGC
CCCAGAATCTAATTGTGAAC
305 55
Exon 5 SSR69
SSR70
GCATGAGAAAACTACTATGAC
CTAACCCTAACTATCAAGATG
196 55
Exon 6 SSR71
SSR72
CACCCAAAAGATATATCTGG
ATTTAGTCCAAAGGAATGCC
224 55
Exon 7 SSR73
SSR74
CCTGCGATTTTCTCTCATAC
ATGTTTGGTACCCACTAGAC
258 55
Exon 8 SSR75
SSR76
AGTAGTAGAATGTTACCAAG
TACTGCAAAAGAGTTAGCAC
382 50
Exon 9 SSR77
SSR78
TGCATTGTTCAAGAGTCAAG
AGTTAGACAATTATCCTCCC
222 55
Exon 10 SSR79
SSR80
TCTTTAATGAAATCTGTGCC
GATATCTAAAGGTCACTAAG
294 55
Exon 11 SSR81
SSR82
GAGACAACAGAAGCATTATAC
CGTGAACAAATCTGAAACAC
247 54
Exon 12 SSR83
SSR84
GGCAGTGTATTTGAAGATAC
AACTACATGTTAGATAGGAG
312 54
Exon 13 SSR85
SSR86
CTTATGTTCAGTAGTTGTGG
TATACGAACTGGAAAGATGC
344 54
Exon 14 SSR87
SSR88
GTGATTTTCTAAAATAGCAGG
TGCCTTGACCTCCTGATCTG
212 62
Exon 15-16 SSR89
SSR90
CAATGCTGACACAAATAAGG
AGCATTCCTTCTCCTTAACC
368 50
Exon 17 SSR91
SSR 92
AAAAATACCTAGCTCAAGGG
TGTTAAGAAACACCTCTCAC
341 56
Exon 18 SSR93
SSR94
TGTACCTGGGAAAATTATGC
CTTTATTTGGGTCATGTACC
339 56
Exon 19 SSR95
SSR96
ATAATCTGTGATTCTTAGCC
AAGAAACATGATTTGAACCC
273 55
Exon 20 SSR97
SSR98
AAAGAGTGGTAGAAAAGAGG
CAGTTAACAAGTAAGTAGGG
335 56
Exon 21 SSR99
SSR100
AAACCTTTCTTTTTTGAGGC
TACATAATAAGGTCAGACAG
328 55
Exon 22 SSR101
SSR102
TAATATGTGCTTCTTACCAGTC
TTTAATGTTTTGGTGGACCC
315 56
Exon 23 SSR103
SSR104
ATCTAATGTAATGGGTCCAC
CTTGGATCAAAATAATCCCC
287 54
Exon 24 SSR1O5
SSR106
GTATTTATGCTCATCTCTGC
TGAGGTGTTTGAATAACTGC
210 60
Exon 25 SSR107
SSR108
GGTTGCTAACTATGAAACAC
AGAAATTGGTATAAGCCAGG
297 54
Exon 26 SSR109
SSR110
AGTAAGTCATCGAAAGCATC
AACGAAAAGACTTCTTGCAG
209 54
Exon 27 SSR111
SSR112
CGCCATCAGTTTGACATGAG
CAGTCACATCTGTGAGAGAC
237 54

L’analyse du gène Rb au niveau constitutionnel et tumoral est réalisée par la chromatographie liquide à haute performance (HPLC) [9] (figures 1 et 2). Les ADN des cas index, ayant donné des profils particuliers (différents du contrôle négatif) par analyse en HPLC, sont séquencés systématiquement.

L’analyse des séquences est effectuée en utilisant deux logiciels :« Seqscanner » (https://products.appliedbiosystems.com/ab/en/US/adirect/ab ?cd = 4cutNavigate 2&cut ID = 600583) et « Multalin » (http://ribosome.toulouse.Inra.fr/multalin/multalin.html) (tableau 1).

Résultats et discussion

L’analyse du gène Rb par HPLC nous a permis d’identifier quatre variations de base au niveau constitutionnel et sept au niveau tumoral concernant six patients. Pour le patient RUS018, aucune variation de base n’a été détectée. Les 15 patients dont seulement l’ADN génomique a été analysé au niveau constitutionnel, ne présentent pas de variation de séquence.

Le séquençage de l’ADN constitutionnel ayant présenté des profils particuliers en HPLC a permis l’indentification de deux mutations exoniques causales et deux polymorphismes. La première mutation siège au niveau de l’exon 1. Elle a pour conséquence l’arrêt prématuré de la traduction donnant ainsi une protéine courte altérée fonctionnellement suite à l’absence des domaines importants se trouvant en aval et qui sont requis pour l’activité de la protéine pRb [10]. La deuxième mutation touche l’exon 7 et provoque un décalage dans le cadre de lecture. Cela a pour conséquence la synthèse d’une protéine tronquée de 211 acides aminés, inactive car les domaines fonctionnels de cette dernière sont codés par la séquence comprise entre les exons 12 et 27 du gène Rb. Les deux mutations touchant l’exon 1 et 7 sont originales et n’ont jamais été décrites par la littérature. Les polymorphismes présents au niveau de l’intron 2 à la position +75 et l’intron 10 à la position +58 ont déjà été décrits dans la bibliographie [11, 12].

Le séquençage du gène Rb au niveau de l’ADN tumoral a permis l’identification de sept variations de bases, comprenant quatre mutations exoniques, une mutation touchant le site accepteur d’épissage et deux polymorphismes introniques. Les mutations exoniques se trouvent au niveau des exons 1, 7, 14 et 18. Elles sont toutes causales étant donné qu’elles entraînent l’apparition d’une protéine tronquée, inactive suite à l’absence de la région comprise entre les exons 12 et 27. En effet, cette région code pour une structure nommée « poche de fixation des oncoprotéines ». Cette poche comprend deux domaines de 179 acides aminés (codon 393 au codon 571) et 125 acides aminés (codon 649 au codon 773), séparés par une zone libre de 76 acides aminés appelée « gap » (codon 572 au 648) [13]. Elle sert à la fixation du facteur de transcription E2F [14]. Cette région est donc requise pour la protéine pRb dans sa fonction régulatrice du cycle cellulaire et toute modification ou mutation survenant à son niveau pourrait altérer cette fonction et sera à l’origine du rétinoblastome chez le sujet portant cette mutation. La variation de base qui est à l’origine d’une anomalie de l’épissage, abolit l’épissage de l’intron 12 par la modification de la séquence consensus GT, correspondant au site donneur d’épissage en AT [15].

Cela entraîne la production d’une protéine plus longue car l’intron 12 va être traduit. Cette variation peut affecter la conformation de la protéine qui aura un impact sur sa fonction régulatrice normale. Une étude fonctionnelle et structurale de la protéine pRb reste nécessaire pour confirmer le rôle de cette mutation. Les deux polymorphismes retrouvés au niveau constitutionnel ont été retrouvés au niveau tumoral. Les mutations touchant les exons 14, 18 et celle affectant le site d’épissage de l’intron 12 ont déjà été décrites par la littérature [16-18] (tableau 2).

Tableau 2 Tableau récapitulatif des résultats obtenus de l’analyse du gène Rb au niveau constitutionnel et tumoral.

Patient 1er événement (au niveau germinal) Conséquence 2e événement (au niveau somatique) Conséquence Rétinoblastome
sporadique
Rétinoblastome transmissible
RUS 004 - - Transition Arg579Stop + -
C → T
150037 du gène
Transition Perturbation du processus d’épissage
G → A
+1 intron 12
RUS 011 Transition
T→ C
+75 intron 2
Transition
G → A
+58 intron 10
Sans conséquence Transition
T → C
+75 intron 2
Transition
G → A
+58 intron 10
Sans conséquence + -
RUS 012 Transversion
G → T
2150 du gène Rb
Glu31Stop Perte d’un alléle Rb Hémizygotie du gène Rb - +
RUS013 Transition
G → A
+58 intron 10
- Transition - + -
G → A
+58 intron 10
Transition Arg445Stop
C → T
76430 du gène Rb
RUS014 Délétion GATC
56875-56879 du gène Rb
212Stop Perte d’un alléle Rb Hémizygotie du gène Rb - +
RUS018 - - - - + -

RUS : rétinoblastome unilatéral sporadique.

L’étude du gène Rb au niveau constitutionnel et tumoral a permis d’identifier, pour le patient RUS012, une transversion G → T à la position 91 de l’exon 1 provoquant ainsi le remplacement de l’acide aminé glutamique par un codon stop. Cette mutation qui n’a jamais été décrite par la bibliographie est présente à l’état hétérozygote au niveau constitutionnel. Par contre, au niveau tumoral, elle se trouve à l’état homozygote. Cela est en parfaite concordance avec la théorie de Knudson, largement confirmée, selon laquelle le premier événement est germinal (pour les formes transmissibles), présent dans toutes les cellules de l’organisme et le second événement somatique correspondant dans notre cas à une perte de l’allèle normal. Cette situation et en faveur d’une perte de l’hétérozygotie car les chances d’avoir une même mutation au niveau des deux allèles du gène Rb et au sein d’une seule cellule sont infiniment rares. Ces deux événements, le premier conduisant à la production d’une protéine courte de 31 acides aminés et le second entraînant la perte de l’allèle sauvage (tableau 2), semblent être la conséquence du développement du rétinoblastome chez notre patient.

Concernant le patient RUS014, nous avons mis en évidence une délétion de 4pb entre les codons 7 et 10 dans l’exon 7. Cette délétion n’a jamais été décrite par la littérature. Elle se trouve à l’état hétérozygote au niveau constitutionnel et l’analyse de cet exon par le logiciel « seqscanner » montre des pics enchevêtrés suite au chevauchement des bases séquencées des allèles normal et muté (figure 3). Au niveau tumoral, nous avons des pics nets tout au long de la séquence montrant ainsi une délétion présente à l’état homozygote (figure 3).

Cette mutation conduit à un décalage dans le cadre de lecture qui entraîne l’apparition d’un codon stop et constitue le premier événement. Le second événement est fort probablement dû à la perte de l’hétérozygotie au niveau tumoral (tableau 1). Ces deux événements pourraient être à l’origine du développement de la pathologie chez le sujet RUS014.

Le patient RUS013 a présenté deux variations de bases, la première est un polymorphisme qui correspond à une transition G → A à la position +58 de l’intron 10. Cette variation de base présente à l’état hétérozygote au niveau constitutionnel et tumoral a déjà été décrite par la bibliographie [12]. La seconde correspond à une mutation par transition C → T en position 1 de l’exon 14 déjà décrite par la littérature [16] (tableau 2). Elle provoque la substitution d’un codon arginine par un codon non sens à la position 445. Le polymorphisme retrouvé au niveau germinal et somatique n’est vraisemblablement pas l’un des événements à l’origine du développement de la maladie. Par contre, une mutation de type non sens est trouvée au niveau somatique. Elle siège dans la région fonctionnelle du gène Rb comprise entre les exons 12 et 27. Un seul événement est donc trouvé chez cet individu et ne permet pas d’expliquer la survenue du rétinoblastome. Ce qui nous conduit à supposer que le second événement pourrait se trouver au niveau post-transcriptionnel ou post-traductionnel. Par ailleurs, l’existence d’autres voies de signalisation pouvant jouer un rôle dans le développement de cette pathologie n’est pas exclue. Il a récemment été montré que dans le rétinoblastome, la défaillance de Rb pourrait conduire à l’inactivation de la protéine p53 en affectant la voie P53 impliquant les gènes p14 Alternate Reading Frame/Mouse Double Minute2/MouseDouble Minute X (p14ARF/MDM2/MDM4) [19].

Dans l’exon 18 et pour le patient RUS004, nous n’avons trouvé aucune mutation au niveau constitutionnel. Par contre, au niveau tumoral nous avons identifié deux mutations, la première correspondant à une transition C → T à la 40e base dans cet exon qui entraîne la substitution de l’acide aminé arginine par un codon stop à la position 579. La seconde mutation entraîne une transition G → A en position +1 de l’intron 12 (tableau 2).

Ces deux mutations décrites par la littérature [17, 18] sont causales car la première se trouve également dans une région fonctionnelle importante du gène et la seconde touche le site donneur d’épissage et perturbe par conséquent ce processus en entraînant la traduction de l’intron 12.

La présence de mutations seulement au niveau somatique pour les cas RUS004 et RUS013 permet de confirmer qu’il s’agit d’un rétinoblastome sporadique et donc il n’existe aucun risque de transmission pour les proches de ces malades ainsi que pour leur descendance.

Pour le cas RUS018, aucune variation de base n’a été détectée, que ce soit au niveau germinal ou bien somatique. Le fait de ne trouver aucune mutation au niveau germinal montre bien qu’il s’agit d’un rétinoblastome sporadique mais par contre l’absence de mutations au niveau somatique nous conduit à suspecter l’intervention d’autres voies de signalisation dans le développement du rétinoblastome [19].

Dix à vingt pourcent des rétinoblastomes n’ont pas de mutation sur le gène Rb [20]. Le développement de cette tumeur peut être soit dû à un virus ou bien à la méthylation du gène, la question fait toujours l’objet de débats à l’heure actuelle.

Les oncoprotéines virales, en particulier la protéine E1A de l’adénovirus et l’antigène T du SV40, ainsi que l’oncoproteine E7 du papillomavirus sont susceptibles de se lier à la protéine pRb. Cette liaison est en relation avec la transformation cellulaire et suggère que ces oncoprotéines transforment la cellule par blocage de la fonction de la protéine pRb, ce qui produirait un effet comparable à une délétion génique et serait à l’origine du rétinoblastome.

Chez le patient RUS011, nous avons identifié un polymorphisme dans l’intron 2, qui correspond à une transition T → C à la position +75 de l’intron. Ce dernier est présent à l’état hétérozygote au niveau constitutionnel et tumoral.

Un second polymorphisme est trouvé dans l’intron 10 chez ce patient et correspond à une transition G → A à la position +58 de l’intron (tableau 2). Cette variation est présente à l’état hétérozygote au niveau germinal et somatique. Ces polymorphismes ont déjà été décrits par la littérature [11, 12].

De manière générale, pour les six patients, ne présentant aucun antécédent familial de la maladie, nous avons identifié pour deux d’entre eux (RUS012 et RUS014) des mutations au niveau germinal montrant ainsi qu’il s’agit d’une forme transmissible du rétinoblastome chez ces deux cas considérés comme sporadiques. Ce résultat n’est pas surprenant sachant qu’il demeure un risque de transmission de 10 à 12 % pour les rétinoblastomes de forme sporadique [21].

Par ailleurs et par cette étude, nous confirmons qu’il n’existe pas pour le gène Rb de sites privilégiés de mutations ou points chauds, les mutations sont dispersées le long du gène.

Les mutations touchant les exons 1 et 7 sont originales car elles n’ont jamais été décrites par la littérature.

Pour les mutations introniques, il est difficile de trancher sur leur causalité. En effet, une mutation n’a pas de valeur tant qu’elle n’est pas validée comme étant responsable de la pathologie. L’éventuelle implication de ces dernières dans la pathologie devrait être prouvée et confirmée par des études structurales et fonctionnelles.

Il serait intéressant d’étudier la méthylation des ilots CpG au niveau de certaines régions du gène Rb, car la substitution de base la plus fréquente qui joue un rôle dans le développement du rétinoblastome est la transition C → T touchant les dinucléotides CpG méthylés [22]. Ces îlots pourraient être considérés comme des régions de prédisposition à des mutations. En effet, sur les 14 codons arginine (CGA) constituant le gène Rb, 11 sont fréquemment mutés [23]. Dans notre étude, cette mutation est présente chez deux individus sur six. La transition C→T modifiant le codon CGA en codon TGA (codon stop) est due à la méthylation des résidus cytosines qui entraîne une déamination spontanée du 5 méthyl cytosine en thymidine [24].

Sur les trois autres codons CGA, se trouvant respectivement sur les exons 1, 26 et 27, aucune mutation, n’a été retrouvée à l’heure actuelle.

Pour ce qui est de l’exon 1, il n’y a pas ce type de mutation au niveau du codon CGA, parce que le dinucléotide CpG n’est pas méthylé, ce qui confirme que la méthylation des îlots CpG confère une prédisposition aux mutations du type déjà cité.

Enfin, pour les exons 26 et 27, aucune mutation n’est retrouvée au niveau des deux codons CGA, cela est expliqué par le fait que la protéine tronquée produite par cette mutation peut avoir une activité suppressive suffisante pour prévenir le développement du rétinoblastome [25].

Conclusion

De manière générale, la situation est différente selon qu’il s’agisse d’un cas sporadique avec un premier événement germinal ou d’un cas à mutations purement somatique.

Pour les patients montrant une anomalie constitutionnelle du gène Rb, une investigation des parents reste primordiale pour distinguer s’ils sont porteurs de l’allèle délétère tout en étant asymptomatique ou bien qu’il s’agisse tout simplement d’une néomutation. Par contre, pour les individus ne présentant pas de mutation au niveau constitutionnel, on peut confirmer qu’il s’agit d’un rétinoblastome non transmissible et qu’il n’est pas nécessaire d’investiguer les membres des familles de ces derniers.

La détection des néomutations est d’un grand intérêt dans le cas du conseil génétique pour les membres d’une famille où il n’existe qu’un cas sporadique de rétinoblastome car elle permet de rassurer définitivement la branche de la famille non concernée par le remaniement.

Conflits d’intérêts: aucun.

Références

1. Doz F, Brisse H, Stoppa-Lyonnet D et al. Retinoblastoma. Paediatric Oncology 2004 ; 323-38.

2. Draper GJ, Sanders BM, Brownbill PA, Hawkins M.M. Patterns of risk of hereditary retinoblastoma and applications to genetic counselling. Br J Cancer 1993 ; 66 : 211-219.

3. Turleau C, Blanquet V, De Grouchy J. Génétique et conseil génétique: le cas du retinoblastoma. Bull cancer 1991 ; 78 : 69-76.

4. Chen PL, Scully P, Shew YT, Wang JYT, Lee W.H. Phosphorylation of the retinoblastoma gene product is modulated during the cell cycle and cellular differenciation. Cell 1989 ; 58 : 1193.

5. Decaprio JA, Ludlow JW, Lynch D, Furukawa Y, Griffin J, Livingston D.M. The product of the retinoblastoma susceptibility gene has properties of a cell regulatory element. Cell 1998 ; 58 : 1085-1095.

6. Sellers WR, Kaelin W.G. Role of the retinoblastoma protein in the pathogenesis of human cancer. J Clin Oncol 1997 ; 15 : 3301-3312.

7. Miller SA, Dakes DD, Polesky H.F. A sample scalting-out for extracting DNA from human nucleated cells. Nucleic acids Res 1989 ; 16 : 1215.

8. Bracete AM, Fox DK, Simms D. Trizol Reagent. Focus 1998 ; 15 : 99.

9. Houdayer C, Gauthier-Villars M, Laugé A, et al. Comprehensive Screening for Constitutional RB1 Mutations by HPLC and QMPSF. Hu Mutat 2004 ; 23 : 193-202.

10. Joseph R. The Rb/E2F pathway and cancer. Human Molecular Genetics 2001 ; 7 : 699-703.

11. Blanquet V, Turleau C, Gross-Morand MS, Senamaud-Beaufort C, Doz F, Besmond C. Spectrum of germline mutations in the RB1 gene a study of 232 patients with hereditary and non hereditary retinoblastoma. Hum Molec Genet 1995 ; 4 : 383-388.

12. Sivakumaran TA, Shen P, Wall DP, Do BH, Kucheria K, Oefner P.J. Conservation of the RB1 gene in human and primates. Hum mutat 2005 ; 25 : 396-409.

13. Dietmar R, Lohmann BR, Brenda L, Gallie D.L. Retinoblastoma: Revisiting the model prototype of inherited cancer. Am J Med Genet 2004 ; 129 : 23-28.

14. Goodrich D.W. The retinoblastoma tumor-suppressor gene, the exception that proves the rule. Oncogene 2006 ; 25 : 5233-5243.

15. Hanna N, Parfait B, Vidaud D, Vidaud M. Mécanismes et conséquences des mutations. Med Sci 2005 ; 21 : 11.

16. Braggio E, Bonvicino CR, Vargas FR, Ferman S, Eisenberg ALA, Seuánez H.N. Identification of three novel RB1 mutations in Brazilian patients with retinoblastoma by “exon by exon” PCR mediated SSCP analysis. J Clin Pathol 2004 ; 57 : 585-590.

17. Dietmar R, Lohmann DR, Brigit B, Wolfgang H, Eberhard P, Bernhard H. The spectrum of RB1 germ line mutations in hereditary retinoblastoma. Am J Hum Genet 1996 ; 58 : 946-949.

18. Nichols KE, Houseknecht MD, Godmilow L, et al. Sensitive multistep clinical molecular screening of 180 unrelated individuals with retinoblastoma detecs 36 novel mutations in the RB1 gene. Hum Mutat 2005 ; 25 : 566-574.

19. Gonin-Laurent N, Hadj-Hamou NS, Vogt N, et al. RB1 and TP53 pathways in radiation-induced sarcomas. Oncogene 2007 ; 26 : 6106-6112.

20. Knudson AG. Historical perspective on retinoblastoma. St jude special seminar, 2005.

21. Doz F. Rétinoblastome aspects récents. Science Direct 2006 ; 13 : 1329-1337.

22. Valverde J, Alonso J, Palacios I, Pestaña A. RB1 gene mutation up-date, a meta-analysis based on 932 reported mutations available in a searchable database. BMC Genet 2005 ; 6 : 53-61.

23. Stenson PD, Ball EV, Mort M, et al. Human gene mutation database (HGMD). Hum Mut 2003 ; 21 : 577-578.

24. Mancini D, Sing S, Ainsworth P, Rodenhiser D. Constitutivelymethylated CpG dinucleotides as mutation hot spots in the retinoblastoma gene (RB1). Am J Hum Genet 1997 ; 61 : 80-87.

25. Hentze MW, Kulozik A.E. A perfect message: RNA surveillance and nonsense-mediated decay. Cell 1999 ; 96 : 307-310.


 

Qui sommes-nous ? - Contactez-nous - Conditions d'utilisation - Paiement sécurisé
Actualités - Les congrès
Copyright © 2007 John Libbey Eurotext - Tous droits réservés
[ Informations légales - Powered by Dolomède ]