ARTICLE
Auteur(s) : Gyula Farkas Jr.1, Peter
Hofner2, Attila Balog2, Tamas
Takács3, Annamaria Szabolcs3, Gyula
Farkas1, Yvette
Mándi2
1Department of Surgery, University of Szeged,
Hungary
2Department of Medical Microbiology and Immunobiology,
University of Szeged, Dóm tér 10, H-6720 Szeged, Hungary
3Department of Internal Medicine, University of Szeged,
Hungary
Chronic pancreatitis (CP) is characterized by dysplastic ducts,
foci of proliferating ductal cells, acinar cell degeneration, and
fibrosis. There are a number of underlying conditions that can
contribute to an increased incidence of CP. They include, but are
not limited to, an excessive ethanol intake, pancreatic stone
formation, and recurrent episodes of acute pancreatitis [1].In the
course of chronic pancreatitis, the pancreatic acinar and ductal
cells undergo continuous destruction and are replaced by fibrous
tissue. An overproduction of extracellular matrix molecules may
further compromise the remaining parenchyma leading to an ongoing
process of tissue destruction, which finally results in an
exocrine, and sometimes endocrine insufficiency. Recent studies
have furnished evidence of an overproduction of various growth
factors, or members of the transforming growth factor-β family
[2-4]. The overproduction of TGF-β in chronic pancreatitis in
particular, appears to be an important factor in the production of
extracellular matrix molecules, inducing the connective tissue
growth factor (CTGF) and subsequently leading to the production of
collagen, fibronectin and proteoglycan.The cytokine TGF-β1, which
plays a central role in the pathogenesis of pancreatic
fibrogenesis, not only exerts immunomodulatory functions but is
also a potent fibrogenic mediator, promoting the proliferation of
fibroblasts and the production of connective tissue. TGF-β is
likely to be involved in the fibrogenetic processes occurring in
chronic pancreatitis, thereby contributing to the loss of
functional, exocrine pancreatic tissue [5]. An upregulated
expression of TGF-β in mononuclear and ductal epithelial cells has
been observed in tissue sections from patients with chronic
pancreatitis [6].The inflammatory processes that characterize
chronic pancreatitis are regulated by a variety of other cytokines,
including tumor necrosis factor-alpha (TNF-α), and also by
chemokines [7]. Thus, chemokines of the C-X-C family, such as
interleukin-8 (IL-8), and the C-C-chemokine family, such as MCP-1,
can be identified in chronic pancreatitis [8, 9].The regulation of
cytokines may be important with regard to susceptibility to the
development of chronic pancreatitis. Recent work has demonstrated a
high degree of polymorphism in the cytokine genes involved in
inflammation and immunity [10].The production of TGF-β1 varies from
individual to individual, and depends, in part, on the
polymorphisms of this gene. The human gene encoding TGF-β1 is
located on chromosome 19q13. A number of polymorphisms have been
described in the TGF-β1 gene, including a T-to-C transition at
nucleotide 29 at position +869, in the region encoding the signal
sequence, which results in a leucine-proline substitution at the
10th amino acid. It has been demonstrated that TT homozygous
genotypes are high TGF-β1 producers [11-13].It has been reported
that a T-A mutation in the -251 promoter region is accompanied by
increased IL-8 production [14]. The G-to-A transition at position
-308 in the promoter region is associated and with an elevated
expression of TNF-α [15, 16].There are conflicting results
concerning the association between TNF-α and TGF-β1 polymorphisms
and chronic pancreatitis [17-19].We have therefore investigated
this in a Central-East European (Hungarian) population, in addition
to an investigation of IL-8 polymorphisms in order to determine
whether polymorphisms of the TGF-β1 gene at position + 869 (codon
10), the TNF-α gene at position -308, and the IL-8 gene at -251
position are associated with chronic pancreatitis.
Patients and methods
Patients
Our study involved 83 patients (24 females and 59 males; mean age
52.7 years, range 22-70), who underwent medical or surgical
treatment for chronic pancreatitis at the Department of Internal
Medicine and/or Department of Surgery of the University of Szeged,
between 2003 and 2006. The diagnosis of chronic pancreatitis was
based on the typical history (daily alcohol intake), abdominal
complaints (pain, bloating, steatorrhoea, etc.) and characteristic
morphological and/or functional alterations of the pancreas. The
morphological changes due to chronic inflammation of the pancreas
(pancreatic calcification on ultrasonography (US) and/or computed
tomography (CT), mild to moderate or marked ductal lesions during
endoscopic retrograde cholangio-pancreatography- (ERCP)
examination) were assessed in each case. Pancreatic calcifications
were found in 31 (37.5%) patients on US or CT.
According to the etiology, 65 of the patients (78.6%) had a
history of alcohol abuse (consumption of > 50 g/day) and 12
(21.4%) patients has idiopathic CP. Exocrine pancreatic
insufficiency was assessed by means of a stool elastase test [20].
Forty seven patients with stool elastase values of less than 200 μg
were considered to have pancreatic insufficiency.
The endocrine function was evaluated in non-diabetic patients by
means of the oral glucose tolerance test (OGTT). Fifty six patients
(67.9%) had impaired endocrine function (latent or manifest
diabetes).
Surgical intervention
The indications for surgery were intractable pain, loss of body
weight, and obstruction of the ductal system (pancreatic duct,
common bile duct or the duodenum) caused by an inflammatory
enlargement of the pancreatic head. These are generally accepted
indications for surgery [21-23]. Duodenum-preserving, pancreatic
head resection [24] was performed in eight cases, organ-preserving,
pancreatic head resection [25] in 15 cases, pylorus-preserving,
pancreatic head resection in four cases, and Wirsungo-jejunostomy
in 13 cases. Rehospitalization and repeat surgery was necessary in
eight cases.
The control group consisted of 75, age- and gender-matched,
healthy blood donors, who had no gastrointestinal or liver
diseases, and who were selected locally from consecutive blood
donors in Szeged, Hungary. The study protocol was approved by the
Ethics and Science Committee of the Ministry of Health and the
University of Szeged Regional and Institutional Committee of
Science and Research Ethics.
All participating subjects were of Hungarian ethnic origin and
resident in Hungary.
DNA extraction
For the study of TNF-α , TGF-β1 and IL-8 polymorphisms, genomic DNA
purified from peripheral blood was used. Leukocyte DNA was isolated
using the High Pure PCR Template Preparation Kit according to the
manufacturer’s instructions (Roche Diagnostic GmbH, Mannheim,
Germany) and the genomic DNA was stored at -20°C until further use.
Determination of TGF-β1 +869 T→C polymorphism
The defined, single-nucleotide polymorphism T29-C in
exon 1 of the human TGF-β1 gene was determined with an
amplification refractory mutation system -ARMS- [26], using a
generic primer (sense), (5’-TCCGTGGGATACTGAGACACC-3’); and with two
allele-specific anti-sense primers, differing from each other in
only one base at the 3’-end- primer C: 5’-GCAGCGGTAGCAGCAGCG-3’ and
primer T: 5’-AGCAGCGGTAGCAGCAGCA-3’. The reaction mixture of 50 μl
contained 100 ng of genomic DNA, 20 pmol each of the sense and the
anti-sense primer, 1.25 U Taq DNA polymerase, 1.5 mM
MgCl2, 1xPCR Taq polymerase buffer +
(NH4)2SO4, and 25 mM of each dNTP
(Fermentas, Vilnius, Lithuania). The thermocycling procedure was as
follows: initial denaturation at 94 °C for 5 minutes; 35 cycles of
94 °C for 30 seconds, 60 °C for 30 seconds and 72 °C for 30
seconds, and a final extension at 72 °C for 5 minutes. The PCR
products were analyzed using 1.5% agarose (Sigma-Aldrich, St. Luis,
MO, USA) gel electrophoresis, visualised under UV illumination and
stained with 0.4 mg/L ethidium bromide. The expected size of
the specific amplification product was 241 bp. Samples from two
known homozygous individuals and one heterozygous individual,
confirmed by sequencing, were included in each reaction. Sequencing
was performed with an automated sequencer (ABI Prism; Applied
Biosystems, CA, USA).
Determination of IL-8 -251 polymorphisms
A single nucleotide T→A polymorphism at -251 nt, relative to the
transcription start site, accompanied by increased IL-8 production
was typed by amplification refractory mutation system (ARMS) [14].
Allele specific primers were: 5′ CCACAATTTGGTGAATTATCAAT 3 (-251A)
and 5′ CACAATTTGGTGAATTATCAAA 3′ (-251T). The consensus primer was:
5′ TGCCCCTTCACTCTGTTAAC 3′, giving a PCR product of 336bp. In each
reaction, a second set of primers for exon 3 of the HLA-DRB1 gene
(forward: 5′ TGCCAAGTGGAGCACCCAA 3′, reverse: 5′
GCATCTTGCTCTGTGCAGAT 3′, product size (796 bp) was used as a
control for PCR efficiency. Reactions were carried out using
Advantage-GC cDNA polymerase mix and buffer (Clontech, Palo Alto,
CA, USA), under the following conditions: 96 °C for
120 s; four cycles of 96 °C for 35 s, 68 °C for
45s, 72 °C for 35s; four cycles of 96 °C for 35 s,
65 °C for 45s, 72 °C for 45s; four cycles of 96 °C
for 35 s, 62 °C for 45s, 72 °C for 55s; ten cycles
of 96 °C for 35 s, 58 °C for 45s, 72 °C for
65s; ten cycles of 96 °C for 35 s, 55 °C for 45s,
72 °C for 75s; four cycles of 96 °C for 35 s,
52 °C for 45s, 72 °C for 85s; four cycles of 96 °C
for 35 s, 50 °C for 45s, 72 °C for 90s; 72°C for
5 min.
Determination of TNF-α -308 G→A polymorphism
This SNP of TNF-α at position –308 in the promoter region was
analyzed by PCR-RFLP (restriction fragment length polymorphism)
[15]. A single base change at the 3’ end of primer A1 was required
for the formation of an NcoI (Fermentas, Vilnius, Lithuania)
recognition sequence CCATGG (instead of GCATG originally found on
the gene investigated) (primer A1:5’-AGGCAATAGGTTTTGAGGGCCAT-3’ and
primer A2:5’-TCCTCCCTGCTCCGAT TCCG-3’). The reaction mixture of 100
μL contained 100 ng of genomic DNA, 20 pmol each of the A1 and the
A2 primer, 2.5 U Taq DNA polymerase, 1.5 mM MgCl2, 1xPCR
Taq polymerase buffer + (NH4)2SO4
(Fermentas, Vilnius, Lithuania) and 25 mM of each dNTP (Fermentas,
Vilnius, Lithuania). The PCR conditions were as follows: initial
denaturation at 94 °C for 3 minutes; 36 cycles of 94 °C for 1
minute, 60 °C for 1 minute and 72 °C for 1 minute, and a final
extension at 72 °C for 5 minutes. The amplified product was
digested with the endonuclease NcoI and analyzed on a 12%
polyacrylamide gel under UV illumination. The TNF G allele gave two
fragments of 87 bp and 20 bp, while the TNF A allele gave
a single, 107 bp fragment.
TGF-β ELISA
Venous blood was collected from healthy blood donors and from
patients with chronic pancreatitis into EDTA-containing tubes for
collecting plasma. Blood was collected from surgical patients
before the operation. Centrifugation was carried out at 2000g for
10 min at 4oC. All samples were stored at
-20 oC. Plasma concentrations of TGF-β1 were
determined by enzyme-linked immunosorbent assay kit (R&D System
Inc., Minneapolis, USA) according to the manufacturer’s
instructions.
Statistical analysis
Statistical analyses for comparison of allele and genotype
frequencies between groups were performed using the χ2
test and Fisher’s exact test if one cell had n < 5. The
probability level of p < 0.05 indicated statistical
significance. The relationship between genotypes and disease
severity is presented as the odds ratio (OR), with a 95% confidence
interval (95% CI).The genotype frequencies for each polymorphism
were tested for deviation from the Hardy-Weinberg equilibrium by
means of the χ2 test, with one degree of freedom used
[27]. The levels of TGF-β1 in the plasma were compared by means of
one-way ANOVA. The Bonferroni test was used for post hoc pairwise
multiple comparisons. In all tests, an α level of p< 0.05
was taken as an indication of statistical significance. All
statistical calculations were performed with the GraphPad Prism4
(GraphPad Software Inc., San Diego, CA, USA) statistical program.
Results
TGF-β1 +869 T→C polymorphism
The genotypic distributions of the +869 T→C polymorphism of the
TGF-β1 gene are shown in table 1. The
distribution of the TGF-β1 genotypes was in accordance with the
Hardy-Weinberg equilibrium in the control population (χ2
= 2.95; p = 0.2676), but not in the patient group with chronic
pancreatitis (χ2 = 5.215, p = 0.022).
There was a significant difference in genotypic distribution
between the chronic pancreatic patients overall and the healthy
controls (p = 0.009, χ2 = 9.409). When the patients were
stratified according progression of the disease - i.e. medical
treatment or surgical treatment – a significant difference was
observed only between the controls and the surgical patients (p =
0.0012), and not between the controls and the patients receiving
only medical treatment. To elucidate the reason for this
difference, we compared the numbers of TT homozygotes among the
patients and the healthy controls. The frequency of TT homozygotes
(high TGF-β1-producing phenotype) was significantly higher in the
patient group overall (50%) than in the controls (28%) (p = 0.005;
OR = 2.634; 95% CI = 1.358-5.111). There was an even higher
freqency of the TT genotype among patients undergoing surgical
intervention as compared with the controls , 62% versus 28%, p =
0.0007, OR = 4.018, 95% CI = 1.796 - 8.987. There was also a
significant difference between the surgical patients, and those
treated medically (p = 0.0486, OR = 2.549, 95%CI = 1.052-6.178).
Although the frequency of the TT genotype was still higher among
the patients in the medically treated (medical) group (39.5%) than
in the controls, the difference was not statistically
significant.
No further significant differences were observed as regards the
SNPs when the patients were stratified according to the presence or
absence of calcification.
Table 1 TGF-β1 +869 genotype distribution in patients
with chronic pancreatitis and in control subjects
|
TT
|
TC
|
CC
|
|
|
Operated
|
25/40 (62%)
|
10/40 (25%)
|
5/40 (13%)
|
p = 0.001a
|
|
p = 0.0007 versus controlb
|
|
|
|
|
Non operated
|
17/43 (39.5%)
|
17/43 (39.5%)
|
9/43 (20%)
|
|
|
p = 0.223 versus control nsb
|
|
|
|
|
p = 0.0486 versus operatedb
|
|
|
|
|
Total
|
42/83 (50%)
|
27/83 (33%)
|
14/83 (17%)
|
p = 0.009a
|
|
p = 0.005 versus controlb
|
|
|
|
|
Control
|
21/75 (28%)
|
30/75 (40%)
|
24/75 (32.%)
|
|
achi-square test versus control.
bFisher test.
TGF-β1 plasma levels
Plasma levels of TGF-β1 were higher in the patients overall than in
controls (3.98 ±1.26 ng/mL versus 2.1 ± 0.85 ng/mL), and higher in
the patients with the TT genotype than in those with the CT and the
CC genotypes (5.2 ± 1.7 ng/mL versus 3.8 ± 1.1 ng/mL and versus 1.5
± 0.5ng/mL respectively; p < 0.001 ANOVA). A similar tendency
was observed in the control group; the subjects with the TT
genotype demonstrated the highest plasma TGF-β1 levels (2.8 ± 0.9
ng/mL) (figure
1). However, the plasma TGF-β1 concentrations differed
significantly between the patients and the controls, both in the TT
homozygote groups and in the TC heterozygote groups. (p < 0.001
statistically significant according the Bonferroni post-test.) No
significant difference was observed between the “low-level” TGF-β1
concentrations when the patients and controls were CC homozygotes.
IL-8 -251 polymorphism
The genotypic distribution of the –251 polymorphism of the IL-8
gene is shown in table 2.
The distribution of IL-8 genotypes was in accordance with the
Hardy-Weinberg equilibrium both in the control population
(χ2 = 2.083, p = 0.148) and in the patient group with
chronic pancreatitis (χ2 = 2.413, p = 0.120).
There was a significant difference in genotype distribution
between the patients and the healthy controls (χ2
= 11.8298, p = 0.0027). There was a higher frequency of
the A/T genotype (high IL-8 producers) among those patients with
chronic pancreatitis as compared with the controls: 48 of the 83
patients (58%) versus 30 of the 75 healthy controls (40%), p =
0.0271; OR = 2.057, 95% CI = 1.090 – 3.882). In spite of this
difference, the statistical power is only 73%. Conversely, the
prevalence of the IL-8 TT, wild type genotype was significantly
lower in the group of patients (15%) than in the control group
(40%) (p = 0.007, OR = 3.590, 95% CI = 1.694-7.607).
There was no significant difference in the genotypic
distribution of IL-8 polymorphism between the two groups of
patients.
Table 2 IL-8 -251 genotype distribution in patients
with chronic pancreatitis and in control subjects
|
TT
|
TA
|
AA
|
|
|
Operated
|
7/40 (17%)
|
23/40 (58%)
|
10/40 (25%)
|
|
|
Non operated
|
6/43 (14%)
|
25/43 (58%)
|
12/43 (28%)
|
|
|
|
ns versus operatedb
|
|
|
|
Total
|
13/83 (15%)
|
48/83 (58%)
|
22/83 (27%)
|
p = 0.0027a
|
|
p = 0.007 versus controlb
|
p = 0.0271 versus controlb
|
|
|
|
Control
|
30/75 (40%)
|
30/75 (40%)
|
15/75 (20%)
|
|
achi-square test versus control.
bFisher test.
TNF-α -308 G→A polymorphism
The distribution of the TNF-α -308 genotypes was in accordance with
the Hardy-Weinberg equilibrium both in the control population
(χ2 = 0.0167, p = 0.897) and in the patient group
(χ2 = 3.483, p = 0.062).
There were no significant differences in the TNF-α -308 promoter
genotypic distribution between the patients with CP and healthy
controls (table 3).
Table 3 TNF-α -308 genotype distribution in patients
with chronic pancreatitis and in control subjects
|
GG
|
GA
|
AA
|
|
|
Operated
|
24/40 (60%)
|
13/40 (32%)
|
3/40 (8%)
|
|
|
Non operated
|
32/43 (74%)
|
8/43 (19%)
|
3/43 (7%)
|
|
|
Total
|
56/83 (67%)
|
21/83 (25%)
|
6/83 (7%)
|
p = 0.417 nsa
|
|
Control
|
52/75 (69%)
|
21/75 (28%)
|
2/75 (3.%)
|
|
achi-square test versus control.
Discussion
An association between genetic predisposition to high production of
TGF-β1 and the risk of developing chronic pancreatitis was found in
Brazilian, mixed-raced people [17]. A similar association was
suggested by Schneider et al., who compared the genotypic
frequencies of polymorphism at position +869 in individuals with
alcoholic chronic pancreatitis and in healthy controls, but they
did not find a statistically significant difference between the
groups. However, they did observe a tendency for individuals with
alcoholic chronic pancreatitis to be homozygous for the T allele
[18].
We investigated the frequency of the TT genotype in patients
with chronic pancreatitis, relative to that in healthy controls,
and also compared the genotypes between patients treated medically
and those undergoing surgery. The latter patients were regarded as
a “ severe” group, with considerable progression of the disease.
The differences in TT genotype frequency proved significant between
the surgical group and the controls, and between the surgical and
the medical group. The frequency of the TT genotype was relatively
high among the medically-treated patients, but only as a tendency
and was without statistical significance.
This means that chronic pancreatitis patients, who do not need
surgery, rather carry the “protective” C allele, while the TT
genotype seems to be a risk factor for surgery. It is noteworthy,
that repeat surgery was necessary within three years in eight
patients , all of whom were TT homozygotes. The highest TGF-β
concentrations (5.2-7.4 ng/mL) were detected in the plasma of these
patients. It is notewoethy, that these patients were heavy
drinkers.
The plasma levels of TGF-β1 were significantly increased among
the chronic pancreatic patients overall as compared with the group
of healthy blood donors (3.98 ±1.26 ng/mL versus 2.1 ± 0.85 ng/mL).
Higher concentrations of TGF-β1 were detected in the plasma of
those subjects with the TT and TC genotypes as compared with those
with the CC genotype, both among the patients and among the
controls (figure 1). The
frequency of high producers (TT) was higher among the patients with
chronic pancreatitis than among the controls (table 1), and the TGF-β1 levels differed in the
patient and control groups (figure 1). It is
tempting to speculate that in the “high producer” patients, the
inflammatory stimuli resulted in elevated levels of TGF-β1, which
further increased the fibrotic processes in the pancreatic
tissue.
The results of other studies support the idea of a role of TNF
in chronic pancreatitis [7, 28]. In our present study, we could not
confirm this result; there was no association found between TNF-α
polymorphism and chronic pancreatitis in our studies. One of the
possible explanations for the conflicting findings might be the
small size of our study.Our results are in line however, with the
report of Schneider and colleagues [18, 29] and with Beranek et al.
[30]. In their study, no association between the TNF-α promoter
polymorphism and chronic pancreatitis was found.
We detected a considerable difference in the IL-8 polymorphism
between the chronic pancreatitis patients and the controls. Howell
et al. [31] reported a non-significant decrease in frequency of the
IL-8 -251 poymorphism in patients with chronic pancreatitis as
compared to the controls, which was unexpected because others have
described an increased expression of IL-8 in chronic pancreatitis
[9]. Our results concerning the association of a higher frequency
of the high IL-8-producing genotype (A/T) with CP is in accordance
with the finding of these authors. No significant difference in
frequencies of the IL-8 polmorphism was observed however, between
the two groups of patients. Accordingly, we presume that the high
IL-8 - producing phenotype may be a predisposing factor for the
development of inflammatory processes in chronic pancreatitis, but
this SNP might not be connected with the severity of the
disease.
We earlier observed a correlation between the IL-8 -251
polymorphism and acute pancreatitis [32]. The relationship between
acute and chronic pancreatitis has long been debated. It is
currently, generally assumed that the onset of CP is closely linked
with recurrent episodes of acute pancreatitis [33]. It is tempting
to speculate that a high IL-8-producing genotype - together with
other predisposing factors (e.g. alcohol consumption) may be a risk
factor for the progression of relapsing alcoholic pancreatitis into
irreversible fibrosis observed in CP.
There was no connection between the IL-8 and TGF-β SNPs.
However, it is noteworthy, that seven of the eight patients who
underwent repeat surgery simultaneously carried the mutant alleles
of IL-8 -251, and were TT homozygotes for TGF-β +869. We
hypothesize that this observation may possibly be of prognostic
value.
In conclusion, it is very likely that both TGF-β1 and IL-8
polymorphisms contribute to the genetic susceptibility to chronic
pancreatitis. The IL-8 -251 polymorphism, with its high
IL-8-producing phenotype may be a risk factor for the development
of chronic pancreatitis, but the presence of this SNP does not
influence the outcome as regards progression, with the necessity
for surgery. In contrast, the TGF-β1 genetic polymorphism with
higher TGF-β1 production appeared relevant among those patients
with chronic pancreatitis who underwent surgery, particularly when
repeat surgey was necessary.
As chronic pancreatitis is a multifactorial disease,
overproduction of cytokines is an important, but not an absolute
factor in the pathogenesis of the disease. Moreover, expression of
TNF-α and TGF-β1 is complex, and is probably modified by haplotype,
cell type and stimulus, therefore care has to be taken not to
over-exaggerate the robustness of the association of SNPs and this
disease.
The small number of subjects in our preliminary study is an
indicator of the need for caution. Although there were significant
differences in the TGF-β TT genotype distributions (table 1) the statistical power of the results was
88% only in the case of comparison the group of patients overall (n
= 83) with the controls. Following the stratification of patients
to surgical (n = 40) and medically-treated groups (n = 43), the
statistical power was 97%, comparing the data for controls with the
patients who underwent surgery. However, when the frequency of the
TT genotype in the two groups of patients was compared, the power
of statistics was only 66%. For a strong (80%) power, the number of
patients in each group should be increased to 80, which requires a
multicenter approach.
Therefore, our results can be regarded as preliminary results,
drawing attention to the possible prognostic value of TGF - β1
polymorphisms and the associated TGF-β1 levels in chronic
pancreatitis, which should be confirmed in a future, multicenter
study on a larger series of patients.
Acknowledgements
We thank Mrs.Györgyi Müller for expert technical assistance and
Mrs. Zsuzsanna Rosztoczy for skillful administration.
This work was supported by Hungarian Research Grant OTKA T
042455. Andras Treszl contributed to the statistical analysis.
References
1 Kloppel G. Progression from acute to chronic pancreatitis. A
pathologist’s view. Surg Clin North Am 1999; 79: 801.
2 Lee MS, Gu D, Feng L, Curriden, et al.
Accumulation of extracellular matrix and developmental
dísregulation in the pancreas by transgenic production of
transforming growth factor β1. Am J Pathol 1995; 147: 42.
3 Van Laethem JL, Deviere J, Resibois A,
et al. Localization of transforming growth factor-beta 1 and
its latent binding protein in human chronic pancreatitis.
Gastroenterology 1995; 108: 1873.
4 Yamanaka Y, Friess H, Büchker MW, et al.
Synthesis and expresseion of transforming growth factor beta-1,
beta-2, and beta-3 in the endocrine and exocrine pancreas. Diabetes
1993; 42: 746.
5 Van Laethem JL, Robberecht P, Resibois A,
et al. Transforming growth factor promotes development of
fibrosis after repeated courses of acute pancreatitis.
Gastroenterology 1996; 110: 576.
6 Slater SD, Williamson RC, Foster CS. Expression
of transforming growth factor-beta 1 in chronic pancreatitis.
Digestion 1995; 56: 237.
7 Berberat PO, Friess H, Buchler MW. Chronic
pancreatitis – new pathophysiological concepts. Swiss Surg 2000; 6:
227.
8 Saurer L, Reber P, Schaffner T, et al.
Differential expression of chemokines in normal pancreas and in
chronic pancreatitis. Gastroenterology 2000; 118: 356.
9 Di Sebastiano P, di Mola FF, di Febbo C,
et al. Expression of interleukin 8 (IL-8) and substance P in
human chronic pancreatitis. Gut 2000; 47: 423.
10 Bidwell J, Keen L, Gallagher G, et al.
Cytokine gene polymorphism in human disease; on-line databases,
supplement 1. Genes Immun 2001; 2: 61.
11 Arkwright PD, Laurine S, Super M, et al.
TGF-beta(1) genotype and accelerated decline in lung function of
patients with cystic fibrosis. Thorax 2000; 55: 459.
12 Awad MR, El-Gamel A, Hasleton P, et al.
Genotype variation in the transforming growth factor-beta gene:
association with transforming growth factor-beta 1 production,
fibrotic lung disease, and graft fibrosis after lung
transplantation. Transplantation 1998; 66: 10140.
13 Hinke V, Seck T, Clanget C, et al.
Association of transforming growth factor-beta 1 (TGF-beta1) T29 →
C gene polymorphism with bone mineral density (BMD), changes in
BMD, and serum concentrations of TGF-beta 1 in a population-based
sample of postmenopausal German women. Calcified Tissue Intern
2001; 69: 315.
14 Hull J, Thomson A, Kwiatkowski D. Association
of respiratory syncytial virus bronchiolitis with the interleukin 8
gene region in UK families. Thorax 2000; 55: 10237.
15 Wilson AG, Giovine FS, Blakemore AIF,
et al. Single base polymorphism in the human tumour necrosis
factor alpha gene detectable by NcoI restriction of PCR product.
Hum Mol Gene 1992; 1: 353.
16 Mira JP, Cariou A, Grall F, et al.
Association of TNF2, a TNF-alpha promoter polymorphism, with septic
shock susceptibility and mortality: a multicenter study. JAMA 1999;
282: 579.
17 Bendicho MT, Guedes JC, Silva NN, et al.
Polymorphism of cytokine genes (TGF-β1, IFN-γ, IL-6, IL-10, and
TNF-α) in patients with chronic pancreatitis. Pancreas 2005; 30:
333.
18 Schneider A, Barmada MM, Slivka A, et al.
Analysis of tumor necrosis factor-α, transforming growth
factor-β1, interleukin-10, and interferon-γ
polymorphisms in patients with alcoholic chronic pancreatitis.
Alcohol 2004; 32: 19.
19 Bohm K, Teich N, Hoffmeister A, et al.
Transforming growth factor-beta-1 variants are not associated with
chronic nonalcoholic pancreatitis. Pancreatol 2005; 5: 75-80.
20 Keim V, Teich N, Moessner J. Clinical value of
a new fecal elastase test for detection of chronic pancreatitis.
Clin Lab (Zaragoza) 2003; 49: 209.
21 Beger HG, Büchler M, Bittner R, et al.
Duodenum-preserving resection of the head of the pancreas in severe
chronic pancreatitis. Ann Surg 1989; 209: 273.
22 Russel C. Indications for Surgery. In: Beger H,
Warshaw A, Büchler M, Carr-Locke DL,
Neoptolemos JP, Russel C, Sarr MG, eds. The
Pancreas. Blackwell-Science, 1998: 815; (vol. 1).
23 Izbicki JR, Bloechle C, Knoefel WT,
et al. Surgical treatment of chronic pancreatitis and quality
of life after operation. Surg Clin North Am 1999; 79: 913.
24 Beger HG, Krautzberger W, Bittner R,
et al. Duodenum-preserving resection of the head of the
pancreas in patients with severe chronic pancreatitis. Surgery
1985; 97: 467.
25 Farkas G, Leindler L, Daróczi M, et al.
Prospective randomised comparison of organ-preserving pancreating
head resection with pylorus-preserving pancreaticoduodenectomy.
Langenbecks Arch Surg 2006; 391: 338.
26 Perrey C, Pravica V, Sinnott PJ, et al.
Genotyping for polymorphisms in interferon-gamma, interleukin-10,
transforming growth factor-beta 1 and tumour necrosis factor-alpha
genes: a technical report. Transplant Immunol 1998; 6: 193.
27 Kocsis I, Vásárhelyi B, Győrffy A, et al.
Missed Calculations and New Conclusions: Re-Calculation of Genotype
Distribution Data Published in Journal of Investigative
Dermatology, 1998–2003. Neurology 2004; 63: 357.
28 Hanck C, Rossol S, Hartmann A, et al.
Cytokine gene expression in peripheral blood mononuclear cells
reflects a systemic immune response in alcoholic chronic
pancreatitis. Int J Pancreatol 1999; 26: 137.
29 Schneider A, Pogue-Geile K, Barmada MM,
et al. Hereditary, familar, and idiopathic chronic
pancreatitis are not associated with polymorphisms in the tumor
necrosis factor (TNF-alpha) promoter region or the TNF receptor 1
(TNFR 1) gene. Genet Med 2003; 5: 120.
30 Beranek H, Teich N, Witt H, et al.
Analysis of tumour necrosis factor alpha and interleukin 10
promotor variants in patients with chronic pancreatitis. Eur J
Gastroenterol Hepatol 2003; 15: 12237.
31 Howell WM, Pead PJ, Shek FW, et al.
Influence of cytokine and ICAM-1 gene polymorphisms on
susceptibility to chronic pancretitis. J Clin Pathol 2005; 58:
595.
32 Hofner P, Balog A, Gyulai Z, et al.
Polymorphism in the IL-8 gene, but not in the TLR4 gene, increases
the severity of acute pancreatitis. Pancreatol 2006; 5: 542.
33 Lankisch PG. Chronic pancreatitis: development from
acute pancreatitis? In: Büchler MW, Friess H, Uhl W,
Malfertheiner P, eds. Chronic Pancreatitis. Novel Concepts in
Biology and Therapy. Blackwell Publ. Co, 2002: 101.
|