ARTICLE
Auteur(s) : Jolanta
Myśliwska1, Joanna Więckiewicz1, Łukasz
Hak1, Janusz Siebert2, Jan
Rogowski3, Krzysztof Szyndler3, Andrzej
Myśliwski4
1Department of Immunology, Medical University of
Gdańsk, Ul. Dębinki 1, 80-210 Gdańsk, Poland Tel.: (+00 48) 58 349
14 33; fax: (+00 48) 58 349 14 33
2Department of Family Medicine, Medical University of
Gdańsk, Poland
3Academic Clinic of Cardiosurgery, Medical University of
Gdańsk, Poland
4Department of Histology, Medical University of Gdańsk,
Poland
accepté le 7 Septembre 2006
Recent studies indicate that the common G>C promoter
polymorphism at position -174 in the 5’ region of the IL6 gene may
have a predictive strength, not only for the risk of cardiovascular
diseases, but also for outcome. The -174GG genotype may be seen as
a portent of future atherosclerosis as it been seen to be
associated with poorer endothelial function, a phenomenon predating
clinical evidence of atherosclerosis by many years, in apparently
healthy young men [1]. In two independent studies, the -174GG
genotype was prognostic for the grade of carotid intima-media wall
thickness in middle-aged and elderly asymptomatic patients [2, 3].
In addition, among the patients who experienced ischemic
cardiovascular events, the -174GG genotype conferred the risk of a
more severe disease pattern, longer hospitalisation after surgical
coronary revascularization, and higher rates of post-operative
complications, including death [4-6].The results of genetic studies
go some way to explain these phenomena on the assumption that the
-174G allele confers a pro-inflammatory profile. Such an hypothesis
has been proposed by authors who found a higher basal serum
concentration of IL6 in patients with the GG genotype as compared
to those carrying the -174C allele [4, 7-9]. The fact that an
elevated interleukin 6 serum concentration has been recognized as a
risk factor of future myocardial infarction among apparently
healthy men [10] and as a predictor of coronary death among
coronary heart disease (CHD) patients [11], may shed light on an
association between the -174G>C IL6 promoter polymorphism and
clinical findings. It is important however, to realize that only
few experimental data on IL6 gene promoter regulation in immune
cells have been published so far [7, 12, 13], and its role in
regulation of the IL6 gene requires further studies. Moreover, the
data obtained on an Italian population seem to be inconsistent with
the hypothesis ascribing a higher risk of CHD to the -174G allele.
From an analysis of this group of 60-year-old Italian men, it
emerged that it was the -174C allele that, either separately [14]
or in combination with the apolipoprotein E polymorphism [15],
increased the risk of acute myocardial infarction.The degree of
severity of CHD depends on the number, size and extent of stenosis
of coronary arteries [16, 17]. It is possible to envisage the scale
of CHD progression on the basis of IL6 gene polymorphisms and IL6
secretion patterns. To our knowledge, such a relationship has not
been described so far. Recently, different inflammatory markers
have been considered as diagnostic in CHD. The fact that
inflammatory markers may reflect the functional status of coronary
arteries in patients with CHD has been shown in studies on the
vasoreactivity of coronary vessels under stress conditions [18]. A
study on patients with effort angina of at least one year duration
and with luminal diameter stenosis of > 50%, revealed the
macrophage colony stimulating factor (M-CSF) as a reliable
inflammatory marker of CHD progression. The plasma level of this
cytokine was related to the number of occluded coronary vessels
[16]. In this paper however, IL6 did not correlate with the number
of occluded vessels. A similar relationship has been sought in
patients with > 50% occlusion of at least one coronary vessel
[17]. None of the inflammatory markers, including CRP, IL6, SAA and
sICAM-1, correlated with disease severity, although a
non-significant tendency towards higher values accompanied advanced
grades of CHD. Summarizing, the expected straightforward
relationship between the status of coronary arteries in CHD
patients and circulating IL6 levels has not been documented. In
addition, it is not known whether IL6 gene promoter polymorphisms
could affect the number of stenosed coronary vessels in CHD
patients.Therefore, we asked whether the –174G>C polymorphism
and the IL6 secretory profile, in vivo and in vitro, may be linked
to the number of occluded coronary arteries in patients with
advanced coronary heart disease.
Patients and methods
Patients
Three hundred and twenty patients, admitted between
October 2002 and November 2003 to the Clinic of
Cardiosurgery of The Academic Clinical Center in Gdańsk and
scheduled for first time elective coronary artery bypass grafting
(CABG), were enrolled into the study. Coronary angiography was
performed in all patients. Qualification for surgery required that
at least one of the major coronary vessels was characterized
with ≥ 75% stenosis. The following coronary arteries were affected:
left anterior descending coronary artery (LAD) or/and right
coronary artery (RCA) or/and circumflex artery (CX). Patients with
one, two and triple vessel disease constituted: 14.4%, 40.5% and
45% respectively. Those patients who in addition to coronary heart
disease, had been diagnosed with or were suspected of having
chronic inflammatory, autoimmune or neoplastic diseases were
excluded from the studies. Moreover, all patients who had suffered
from any acute infection within the last three months were also
excluded from the study. The clinical data were entered into a
computerized database. A hundred healthy, age-matched (63.2 ± 6.7
years old; 70% of men and 30% women) people were enrolled as the
control group. They had never presented clinical symptoms of CHD
and had a normal resting and exercise-related electrocardiogram.
They did not have any history of arterial hypertension or diabetes
mellitus. They were recruited for comparison with CHD patients for
distribution of the –174G>C genotype. Written informed consent
was obtained from all participants. The study was approved by the
Ethics Committee of the Medical University of Gdańsk. The
investigation also conforms to the principles outlined in the
Declaration of Helsinki (Cardiovascular Research 1997; 35: 2-4).
Hypertension was defined as systolic blood pressure ≥ 140 mmHg or
diastolic blood pressure ≥ 90 mmHg, or the self-reported use of
anti-hypertensive medication. Diabetes was defined according to the
American Diabetes Association (Diabetes Care 2005; 28: 37-42).
Information on the initial diagnosis, smoking history, medication
and infections was obtained by interview. Angina pectoris was
graded according to the Canadian Cardiovascular Society
Classification for angina pectoris (CCS). The New York Heart
Association (NYHA) functional classification of patients with heart
disease was applied to describe the patient’s state. The European
System for Cardiac Operative Risk Evaluation (Euroscore) was used
for evaluation of the operative risk for the patients.
Methods
Plasma measurements
Blood was taken the day before surgery. Blood was drawn from the
ante-cubital vein between 7 and 8 o’clock, frozen in aliquots
(-70°C) and used not later than 3 months thereafter. Fasting serum
lipids were measured with the enzymatic kits: “Comray Chol”,
“Comray HDL-Direct” and “Comray-TG” (P.Z. Comray, Poland).
High-sensitivity CRP was measured with a particle-enhanced,
immuno-nephelometric assay (N Latex CRP mono, Behring Diagnostics).
This assay detects values as low as 0.175 mg/L.
Genotyping protocols
Genomic DNA was isolated with DNA Prep Plus Kit (DNA Gdańsk,
Poland) according to the protocol.
IL-6 gene polymorphism
IL-6 gene polymorphism in position -174 was analysed using the
PCR-RFLP method, as described Fishman et al. [7]. Briefly, PCR was
performed with primers 5’ AGAAGAACTCAGATGACTGG 3’ and 5’
GCTGGGCTCCTGGAGGGG 3’. PCR conditions: 40ng genomic DNA, 10pmol of
each primer, 200 µM, dNTP, 2 mM MgCl2,
0.5 U DyNAzyme II DNA Polymerase (Finnzymes, Finland), water
to the volume of 50 μl. Temperature profile: 95°C 1 mn,
63°C 1 mn, 72°C 2 mn 30 cycles, final elongation 72°C
10 mn. The PCR products were cut by restriction enzyme SfaNI
(NEB) at 37°C for 12h, after which agarose electrophoresis was
performed in 2% gel stained with ethidium bromide.
Whole blood cell cultures (WBCC)
Whole blood was collected into EDTA Vacutainer tubes. Five-hundred
μl of whole blood was diluted (1:1) with RPMI (Gibco, Life
Technologies Inc., USA) containing 5% fetal calf serum (Gibco, Life
Technologies Inc., USA) and incubated in a humidified atmosphere
containing 5% CO2 at 37°C for 24 h and 48 h on
24-well, plastic plates (Corning, Science Products, New York, USA)
without any additional stimulants. Before plating, blood was
adjusted for an equal WBC number in a unit volume so that equal
numbers of WBC were put into each well of the plate. The samples
were prepared in triplicate. After incubation, the supernatants
were removed and kept at -70oC. Spontaneous IL6
secretion was evaluated in culture supernatants.
Bioassay for interleukin 6
Bioassay for IL6 was performed as previously described [28]. The
IL6-dependent murine hybridoma cell line B9 was cultured for 48
hours on 96-well plastic plates (Corning, Science Products,
Rochester, NY, USA) at a concentration of
20x103cells/well and 10x103cells/well
respectively in RPMI medium (Gibco, BRL Life Technologies,
Gaithersburg, USA) containing 5% FCS (Gibco, BRL Life Technologies,
Gaithersburg, USA), 2 mmol L-glutamate and penicillin-streptomycin
(Sigma Chemical Co., St. Louis, USA). Ten μl of the sera were added
to each well of the plate, in triplicate. Cell viability was
measured using the colorimetric MTT assay. The optical densities
obtained from experimental wells were fitted with titration
standards of rIL6. Neutralizing rabbit anti-IL6 antibodies
(Genzyme, Cambridge, MA, USA) were added (1:10, 1:20, 1:50) in
order to confirm the specificity of the test. The parallel control
samples received normal rabbit serum (1:50). All neutralizing
antibodies completely blocked the three biological tests. The IL6
assay had a detection limit of 1.0 pg/mL. The intra-assay
coefficients of variation ranged between 8.5 and 12.8%. The
inter-assay coefficient of variation ranged between 16 and 25%. The
results were read at 570 nm on the automated plate reader
(Multiscan MCC/340, Labsystems, and Helsinki, Finland).
Statistical analysis
The results were analysed using the Statistica, Version 6 program
(StatSoft, Pl). Continuous variables were tested for normality
using the Kolmogorov-Smirnov test. Normally distributed variables
were analysed with the ANOVA test. For comparison of the
skew-distributed variables the non- parametric Kruskal-Wallis ANOVA
and Mann-Whitney U tests were applied. All results were presented
as an arithmetic mean ± SD. Nominal variables were analysed using
the χ2 Pearson test. Conformation of the allele
frequencies to Hardy-Weinberg equilibrium proportions was tested by
the χ2 test. The multivariate linear stepwise regression
was applied to assess correlates of multivessel CHD. The level of
significance was set at p < 0.05 and two-sided tests were
performed as the standard.
Results
General characteristics of patients
The preoperative characteristics of the patients are presented in
table 1( Table 1 ). There were no
significant differences between the traditional cardiovascular risk
factors, metabolic parameters, medications used and cardiovascular
status of patients with different -174G>C IL6 genotypes. The
distribution of the –174G>C genotypes was similar (p = 0.5) in
the CHD patients (GG = 28.9%; GC = 47.5%; CC = 23.6%) and the
healthy controls (GG = 32%; GC = 47%; CC = 21%), and was compatible
with the Hardy-Weinberg equilibrium.
Table 1 Basic clinical parameters in patients with
different IL6 -174G>C genotypes
|
–174 IL-6 genotype
|
GG
|
GC
|
CC
|
p value
|
|
N (%)
|
93 (29)
|
151 (47)
|
76 (24)
|
|
|
Age (years)
|
63.5 ± 9.2
|
61.3 ± 8.8
|
63.1 ± 8.3
|
0.12
|
|
Duration of disease
|
9.3 ± 8.0
|
7.6 ± 6.5
|
7.0 ± 7.1
|
0.1
|
|
Men #
|
76.0
|
69.5
|
74.3
|
0.51
|
|
Hypertension #
|
63.0
|
73.4
|
66.0
|
0.25
|
|
Diabetes #
|
33.0
|
27.0
|
21.0
|
0.26
|
|
Smokers #
|
|
Current
|
8
|
9
|
14
|
0.52
|
|
Ex-smokers
|
64
|
67
|
56
|
|
|
Non-smokers
|
28
|
24
|
30
|
|
|
Body mass index, (kg/m2)
|
27.8 ± 4.0
|
28.4 ± 4.1
|
28.0 ± 4.0
|
0.51
|
|
Total cholesterol (mmol/L)
|
5,54 ± 1,21
|
5,67 ± 1,36
|
5,49 ± 1,26
|
0,60
|
|
LDL (mmol/L)
|
3.74 ± 1.16
|
3.43 ± 1.10
|
3.45 ± 1.13
|
0.22
|
|
HDL (mmol/L)
|
1.13 ± 0.30
|
1.13 ± 0.36
|
1.16 ± 0.28
|
0.85
|
|
TGL (mmol/L)
|
1.70 ± 0.73
|
1.86 ± 1.38
|
1.85 ± 1.13
|
0.85
|
|
Beta-blockers #
|
77
|
88
|
79
|
0.07
|
|
ACEI #
|
68
|
64
|
70
|
0.67
|
|
Statins #
|
84
|
75
|
78
|
0.28
|
|
ASA #
|
98
|
91
|
92
|
0.09
|
|
CCS #
|
|
|
|
|
|
1
|
6.5
|
4.0
|
5.5
|
0.96
|
|
2
|
32.5
|
36.5
|
31.5
|
|
|
3
|
52.0
|
50.0
|
55.0
|
|
|
4
|
9.0
|
9.5
|
8.0
|
|
|
Previous MI #
|
63.3
|
65.3
|
60.8
|
0.80
|
|
ARRAY(0x30c684)
|
|
Number of MI #
|
|
|
|
|
|
0
|
36
|
35
|
39
|
0.51
|
|
1
|
45
|
44
|
43
|
|
|
2
|
14
|
18
|
15
|
|
|
3
|
4
|
3
|
3
|
|
|
4
|
1
|
0
|
0
|
|
|
Previous PTCA #
|
10.0
|
9
|
13.0
|
0.72
|
|
LVEF before surgery
|
51.1 ± 10.4
|
51.6 ± 7.9
|
52.4 ± 8.5
|
0.64
|
|
NYHA class #
|
|
|
|
|
|
1
|
60.0
|
56.0
|
67.0
|
0.50
|
|
2
|
10.0
|
15.5
|
6.5
|
|
|
3
|
19.0
|
20.0
|
17.0
|
|
|
4
|
11.0
|
8.5
|
9.5
|
|
|
EuroSCORE
|
3.46 ± 2,5
|
3.8 ± 2,44
|
3.10 ± 2,2
|
0.47
|
Status of coronary arteries
Carriers of the -174G>C genotypes differed in the number of
severely (≥ 75% stenosis) obstructed coronary arteries.
Significantly (p = 0.001) more patients (56.6%) with triple vessel
disease [i.e. left anterior descending coronary artery (LAD), right
coronary artery (RCA) and circumflex artery (CX)] were found within
the -174GG group as compared to the -174GC (41%) and CC (38.8%)
genotype-carrying patients (table 2( Table
2 )).
Table 2 IL6 gene polymorphism and number of obstructed
coronary vessels
|
Affected vessels
|
- 174 G>C
|
|
GG
|
GC
|
CC
|
|
1
|
2 (3.3%)
|
32 (21.5)
|
11 (14.6)
|
|
2
|
38 (40.1)
|
57 (37.5)
|
36 (46.6)
|
|
3
|
53 (56.6)
|
62 (41)
|
29 (38.8)
|
- Statistical
- significance
- (Pearson χ2)
|
p = 0.001
|
IL-6 serum level and the -174G>C polymorphism
IL6 serum levels were dependent on the –174 G>C polymorphism
(p = 0.007). The highest level was found in the -174GG and the
lowest in -174CC genotype (post hoc: GG versus CC p = 0.03 and GG
versus GC p = 0.001) patients. Further, patients were subdivided
into groups with and without previous acute myocardial infarction
(MI). It appeared that the -174GG genotype carriers, who had
suffered at least one MI, were characterized by higher serum IL6
levels than those without MI in their history (p = 0.03). In
patients with other genotypes there was no difference in IL6 serum
levels between post-MI patients and those without history of MI
(table 3( Table 3 )).
Table 3 Concentration of IL6 in serum according to IL6
-174G>C genotypes
|
Genotypes
|
-174GG
|
-174GC
|
-174CC
|
Statistical significance
|
|
Patients n (%)
|
90 (29)
|
150 (48)
|
70 (23)
|
|
|
IL6 pg/mL
|
*44.1 ± 29.5
|
37.0 ± 24.1
|
18.4 ± 7,1
|
p = 0.007
|
|
Myocardial infarction
|
0
|
1
|
0
|
1
|
0
|
1
|
p
|
|
IL6 pg/mL
|
**21 ± 15
|
40 ± 32#
|
44 ± 18
|
39 ± 17##
|
18 ± 7
|
18 ± 4
|
#0.03
|
##0.5
|
###0.9
|
Secretion of IL6 in vitro and the 174G>C polymorphism
Whole blood cell cultures of all patients were carried out for
4 h, 24 h and 48 h on 24-well plastic plates without
any stimulants. The spontaneous IL6 secretion into culture
supernatants appeared to be significantly higher at all time points
in the -174GG as compared to the CC and GC genotype carriers
(4 h, p = 0.04; 24 h, p = 0.03; 48 h, p = 0.04) (
(figure 1)
).
IL6 serum levels and obstructed coronary arteries
The patients were divided into one, two or triple vessel groups if
they had the following coronary arteries affected with ≥ 75%
stenosis: left anterior descending coronary artery (LAD) or/and
right coronary artery (RCA) or/and circumflex artery (CX). Serum
IL6 concentrations were clearly increasing with the number of
obstructed coronary vessels (p = 0.0001) ( (figure 2) ).
IL6 in vitro secretion and obstructed coronary arteries
Next, we concentrated on the relationship between in vitro IL6
secretion and the number of vessels affected with ≥ 75% stenosis.
Spontaneous IL6 secretion by WBCC was measured in non-stimulated
24 h and 48 h cultures. It appeared that spontaneous IL6
secretion after 24 h and 48 h was directly related to the
number of severely stenosed arteries 24 h (p = 0.03) and
48 h (p = 0.03) ( (figure 3) ).
Serum CRP level, -174G>C IL6 polymorphism and obstructed
vessels
The values for CRP remained in a similar range (p = 0.7) for
patients with single (1.4 ± 0.8 mg/L), double
(1.5 ± 1.2 mg/L) and triple (1.7 ± 1.2 mg/L) vessel
disease. There was no correlation between the circulating IL6 and
CRP levels (p = 0.7). The IL6 gene polymorphism did not correspond
to the CRP values (p = 0.8).
The multivariate linear regression, adjusted for the classical
risk factors such as age, total cholesterol, HDL-cholesterol, BMI,
smoking, history of hypertension and diabetes mellitus, and family
history of CHD revealed that CHD duration (β = 0.176
p = 0.0005) and the -174G>C polymorphism (β = 0.152
p = 0.0005) remained in positive association with multi-vessel CHD.
This association was independent of the classical risk factors.
Discussion
We are, to our knowledge, the first to demonstrate that the
–174G>C polymorphism may be associated with the number of
critically occluded, main coronary arteries. We have shown that
carriers of the -174GG genotype were significantly more likely to
have triple vessel disease (with ≥ 75% stenosis of the LAD, RCA and
CX) than patients heterozygous and homozygous for the -174C allele.
Moreover, serum IL6 concentrations as well as spontaneous, in vitro
IL6 secretion remained significantly higher in the -174GG genotype
carriers than in the -174GC and -174CC genotypes. These findings
were complemented by the results of in vivo and in vitro IL6
secretion profiles. Both the IL6 serum concentrations and
spontaneous IL6 secretion from in vitro WBCC cultures were directly
related to the number of severely stenosed (≥ 75%) coronary
vessels i.e. left anterior descending coronary artery, right
coronary artery and circumflex artery.
The hyper-responsiveness of the –174GG patients, found in our
study, is consistent with molecular studies on IL6 gene promoter
regulation. The –174G>C polymorphism has been regarded as a key
regulator of downstream IL6 production. IL6 mRNA expression
requires a synergistic interaction of a number of transcriptional
factors, including NF-κB, NF-IL6 and C-JUN/AP-1. The -174
polymorphic IL6 gene region is located in close proximity of such
transcription factors as NF-κB, NF-IL6, C-JUN/AP-1. The G>C
nucleotide substitution creates a potential binding site for the
transcription factor NF-1 [7, 12, 13]. The -174G allele has been
found to have much higher promoter strength than the C allele both
in the in vitro model of transfected cells [7] and in ex vivo IL6
production by whole blood cell cultures [12]. The
hyper-responsiveness of the –174GG patients compared to the other
genotypes has been noted in recent clinical analyses which revealed
the highest IL6 plasma levels in patients awaiting CABG, and in
coronary angioplasty patients [8, 9].
Our results document a significant and direct relationship
between serum IL6 levels, spontaneous in vitro IL6 production and
the number of severely occluded coronary vessels. Past papers have
failed to document a significant relationship between different
inflammatory markers such as CRP, IL1β, IL6, IL8, SAA, fibrinogen,
sICAM-1, VCAM-1, E-selectin, WBCC count and the number of stenosed
coronary arteries, as assessed by different quantitative methods
[17, 19, 20]. The discrepancy between our and previous results may
be due to a different study model. We have analyzed more numerous
groups and patients with more advanced coronary artery stenosis. In
contrast to other authors, we applied a sensitive bioassay with the
IL6-dependent B9 hybridoma plasmocytoma cell line, destined for
detection of only bioactive IL6 [21]. This assay measures IL6 both
free and complexed with sIL6R; the forms which are able to bind to
cellular receptors and induce a specific biological response [22].
The immunoreactive IL6, which is measured using ELISA-based
methods, detects active IL6 complexes as well as IL6 plus the
sgp130 molecule. The IL6-sgp130 complex, by competing with IL6
receptors, inhibits IL6 biological activity [23].
The wide variety of IL6 values might have been due to the
seasonal variability of IL6 [24] or the depressive mood [25] of
patients, who were recruited consecutively over several months and
with blood taken the day prior to surgery.
The associations between the -174G>C polymorphism and the
number of stenosed vessels, and between IL6 secretion and affected
coronary arteries, were independent of the classical risk factors.
Such a tendency is in line with other clinical reports revealing
the absence of a link, between either IL6 gene polymorphisms or
plasma IL6 level and traditional cardiovascular risk factors [19,
26].
It might be speculated that the –174GG IL6 hyper-producers are
more endangered, than other genotype carriers, with unwanted
consequences. IL6, by virtue of its inflammatory activity, may
promote new lesion formation and may enable an enlargement of the
already existing ones. This effect may be mediated by activated
monocytes [27], which were the prevalent IL6 producers in our
study, and the clonal expansion of pathogenic T helper cells [28].
Such an assumption may stem from animal experiments. IL6-treated
atherosclerosis-prone mice have been found to develop more and much
larger lesions than did non-treated animals [29]. IL6 may enhance
coagulation and thrombosis by stimulation of platelet aggregation,
expression of tissue factor and synthesis of fibrinogen [30].
Finally, high IL6 plasma levels may be responsible for an
alteration of plaque morphology from the stable to the vulnerable
form. The latter is the main cause of acute cardiovascular events
[31].
How may we reconcile our results with those for Italian MI
patients, which indicate a predictive strength of the -174CC
genotype and -174C allele for acute MI [14, 15]? These two sets of
results do not seem to be mutually exclusive. The association found
in our paper between the -174GG genotype, IL6 secretion and
stenosed coronary arteries refers to advanced CHD, of 7-9 years
disease duration, and with severe lesions in two or three main
coronary arteries. About 70% of these patients had suffered from
one to four myocardial infarctions. So, a chronic, long-term
inflammatory process may not be the equivalent, in terms of
pathogenesis, of an acute MI, which is an athero-thrombotic event.
This predictive role of the -174GG genotype for severe coronary
artery stenosis may become more similar in the Italian group, as
their disease progresses. There is also another explanation for the
discrepancy. A approximate analysis suggests that the distribution
of the -174G>C genotypes in Italian and Polish populations may
be different. So, the functional impact of the -174G>C genotype
may be dissimilar. Such hypotheses however, need to be
substantiated.
The contemporary anti-inflammatory therapies for CHD are
targeted against CRP and other acute phase reactants. Meanwhile, we
and others [17, 19, 20] did not find a relationship between the
number of stenosed coronary arteries and blood CRP levels. The
relationship found in our study inclines us against high
IL6-targeted therapy. Such a therapy should, be important for the
-177GG genotype CHD carriers in particular. For this purpose, the
ASA preparations should be strongly recommended as they exert a
prominent and broad anti-inflammatory effect, including reduction
of IL6 activity [16]. Recent papers indicate that the rate of
atherosclerotic plaque initiation and growth, as well as their
switch from stable to vulnerable forms, is dependent on angiotensin
II, and this process is mediated by IL6 [31, 32]. A selective AT1
antagonist appeared to be the choice for reducing IL6 synthesis
[32]. The blockade of AT1 receptor appeared to be superior to the
ACE inhibitors in the reduction, not only CRP but also IL6 levels
in CHD patients [33]. In searching for strategies for preventing
atherosclerotic plaque development, an additive effect in
APOE-/- mice fed a high-fat diet, has been obtained with
a combined RAS blockade plus HMG-CoA reductase inhibitors [34]. The
combination of RAS blockade with simultaneous ASA treatment
recently tested in patients appears to be a promising
anti-inflammatory approach [35]. Statins, known from their potent
ability to reduce acute reactants such as CRP and SAA appeared not
to influence IL6 production [36, 37].
Understanding the effect of anti-inflammatory drugs could help
to explain why an expected correlation between IL6 and CRP levels
was not noticed in our paper, and patients with advanced coronary
lesions were characterized by relatively low CRP values. This was
the result of long-term, combined anti-inflammatory treatment with
ASA, ACEI, β-blockers and statins. This therapy, as discussed
above, was preferentially directed towards CRP and did not appear
to have a significant effect on IL6 production. How then, in light
of numerous observational cohort studies performed by Ridker and
his group, should CRP and IL6 levels be considered in relation to
patient prognosis? Numerous papers from the Ridker’s study group
revealed that blood CRP concentration is an important, independent
cardiovascular risk factor in healthy populations of both sexes
[38]. These results do not match those for our patients with
advanced CHD. New studies placed CRP as an independent constituent
of the global risk prediction model in healthy populations [39,
40]. The conclusions of these studies cannot be valid for the
patients examined in our paper. Recently, CRP levels appeared to be
an independent predictor of ischemic stroke in patients with
pre-existing cardiovascular disease [41]. According to the
stratification model in this paper, our medically controlled
patients have a low risk of future stroke. Interleukin 6 can also
serve as an independent risk factor for cardiovascular events in
healthy men [42] and women [43], as well as in patients with
pre-existing cardiovascular disease [44]. However, confirmation of
a stratification risk for our patients requires longer
observational study.
Our results, indicating a relationship between the number of
severely stenosed coronary arteries and IL6 secretion, in
combination with the -174G>C polymorphism, emphasize the role of
IL6 as an important, non-classical factor that contributes to the
development of severe atherosclerosis. They also suggest the need
for targeted therapy, specifically directed against high IL6
levels.
Acknowledgements
This paper was supported by The State Committee for Scientific
Research (Project No 3P05B 175 22) and ST28.
References
1 Brull DJ, Lesson CP, Montgomery HE, Mullen M,
deDivitiis E, Humphries SE, Deanfield JE. The effect
of Interleukin-6-174G>C promoter gene polymorphism on
endothelial function in healthy volunteers. Eur J Clin Invest 2002;
32: 153.
2 Rauramaa R, Vaisanen SB, Luong LA,
Schmidt-Trucksass A, Penttila IM, Bouchard C,
Toyry J, Humphries SE. Stromelysin-1 and interleukin-6
gene promoter polymorphisms are determinants of asymptomatic
carotid artery atherosclerosis. Arterioscler Thromb Vasc Biol 2000;
20: 2657.
3 Rundek T, Elkind MS, Pittman J,
Boden-Albala B, Martin S, Humphries SE, Juo SH,
Sacco RL. Carotid intima-media thickness is associated with
allelic variants of stromelysin-1, Interleukin 6, and hepatic
lipase genes. The Northern Prospective Cohort Study. Stroke 2002;
33: 1420.
4 Burzotta F, Iacoviello L, Di Castelnuovo A,
Glieca F, Luciani N, Zamparelli R,
Schiavello R, Donati MB, Maseri A, Possati G,
Andreotti F. Relation of the -174 G/C polymorphism of
interleukin-6 to interleukin-6 plasma levels and to length of
hospitalization after surgical coronary revascularization. Am J
Cardiol 2001; 88: 1125.
5 Gaudino M, Di Castelnuovo A, Zamparelli R,
Androetti F, Burzotta F, Iacoviello L,
Glieca F, Alessandrini F, Nasso G, Donati MB,
Maseri A, Schiavello R, Possati G. Genetic control
of postoperative systemic inflammatory reaction and pulmonary and
renal complications after coronary artery bypass surgery. J Thorac
Surg 2003; 126: 1107.
6 Gaudino M, Andreotti F, Zamparelli R, Di
Castelnuovo A, Nasso G, Burzotta F,
Iacoviello L, Donati MB, Schiavello R,
Maseri A, Possati G. The -174G/C Interleukin-6
polymorphism influences postoperative interleukin-6 levels and
postoperative atrial fibrillation. Is atrial fibrillation an
inflammatory complication? Circulation 2003; 108: 195.
7 Fishman D, Faulds G, Jeffery R,
Mohamed-Ali V, Yudkin JS, Humphries S, Woo P.
The effect of novel polymorphisms in the interleukin-6 (IL-6) gene
on IL-6 transcription and plasma IL6 levels, and an association
with systemic-onset juvenile chronic arthritis. J Clin Invest 1998;
102: 1369.
8 Trevelyan J, Brull DJ, Needham EWA,
Montgomery HE, Morris A, Mattu RK. Effect of
enalapril and losartan on cytokines in patients with stable angina
pectoris awaiting coronary artery bypass grafting and their
interaction with polymorphisms in the interleukin-6 gene. Am J
Cardiol 2004; 94: 564.
9 Merino A, Gaya A, Segura I, Calvo J,
Imizcoz C, Berenguel A, Alegria E. Platelet
aggregation inhibition blocks C-reactive protein and interleukin-6
elevation after the coronary angioplasty: effect of the -174G/C IL6
gene polymorphism. Am J Cariol 2004; 94: 1300-3.
10 Ridker PM, Rifai N, Stampfer MJ,
Hennekens CH. Plasma concentration of Interleukin-6 and the
risk of future myocardial infarction among apparently healthy men.
Circulation 2000; 101: 1767.
11 Luc G, Bard JM, Juhan-Vague I,
Ferrieres J, Evans A, Amouyel P, Arveiler D,
Fruchart JC, Ducimetiere P. C-reactive protein,
Interleukin-6, and fibrinogen as predictors of coronary heart
disease. The PRIME study. Arterioscler Thromb Vasc Biol 2003; 23:
1255.
12 Rivera-Chavez FA, Peters-Hybki DL, Barber RC,
O’Keefe GE. Interleukin-6 promoter haplotypes and
interleukin-6 cytokine responses. Shock 2003; 20: 218.
13 Terry CF, Loukaci V, Green FR. Cooperative
influence of genetic polymorphisms on Interleukin 6 transcriptional
regulation. J Biol Chem 2000; 275: 18138.
14 Chiappelli M, Tampieri C, Tumini E,
Porcellini E, Caldarera CM, Nanni S, Branzi A,
Lio D, Caruso M, Hoffmann E, Caruso C,
Licastro F. Interleukin-6 gene polymorphism is an
age-dependent risk factor for myocardial infarction in men. Int J
Immunogenet 2005; 32: 349.
15 Licastro F, Chiappelli M, Caldarera CM,
Tampieri C, Nanni S, Gallina M, Branzi A. The
concomitant presence of polymorphic alleles of interleukin-1beta,
interleukin-6 and apolipoprotein E is associated with an increased
risk of myocardial infarction in elderly men. Results from a pilot
study. Mech Ageing Dev 2004; 125: 575.
16 Ikonomidis I, Andreotti F, Economou E,
Stefanadis C, Toutouzas P, Nihoyannopoulos P.
Increased proinflammatory cytokines in patients with chronic stable
angina and their reduction by aspirin. Circulation 1999; 100:
793.
17 Rifal N, Joubran R, Yu H, Asmi M,
Jouma M. Inflammatory markers in men with angiographically
documented coronary heart disease. Clin Chem 1999; 45: 1967.
18 Tomai F, Crea F, Gaspardone A, Versaci F,
Ghini AS, Chiariello L, Gioffre PA. Unstable angina
and elevated C-reactive protein levels predict enhanced
vasoreactivity of the culprit lesion. Circulation 2001; 104:
1471.
19 Pearson TA, Mensah GA, Alexander RW,
Anderson JL. Markers of inflammation and cardiovascular
disease. Application to clinical and public health practice. A
statement of healthcare professionals from Centers for Disease
Control and Prevention and The American Health Association.
Circulation 2003; 107: 499.
20 Zebrack JS, Muhlestein JB, Horne BD,
Anderson JL. Intermountain Heart Collaboration Study Group.
C-reactive protein and angiographic coronary artery disease:
independent and additive predictors of risk in subjects with
angina. J Am Coll Cardiol 2002; 39: 632.
21 Cote S, Lemieux R, Simard C. The survival of
IL-6-dependent myeloma cells critically relies on their capability
to transit the G1 to S phase interval of the cell cycle. Cell
Signal 2005; 17: 615.
22 Mitsuyama K, Tomiyasu N, Suzuki A,
Takaki K, Takedatsu H, Masuda J, Yamasaki H,
Matsumoto S, Tsuruta O, Toyonaga A, Sata M. A
form of circulating interleukin-6 receptor component soluble gp130
as a potential interleukin-6 inhibitor in inflammatory bowel
disease. Clin Exp Immunol 2006; 143: 125.
23 Mackiewicz A, Schooltink H, Heinrich PC,
Rose-John S. Complex of soluble human IL-6-receptor/IL-6
up-regulates expression of acute-phase proteins. J Immunol 1992;
149: 2021.
24 Myrianthefs P, Karatzas S, Venetsanou K,
Grouzi E, Evagelopoulou P, Boutzouka E,
Fildissis G, Spiliotopoulou I, Baltopoulos G.
Seasonal variation in whole blood cytokine production after LPS
stimulation in normal individuals. Cytokine 2003; 24: 286-92.
25 Trzonkowski P, Mysliwska J, Godlewska B,
Szmit E, Lukaszuk K, Wieckiewicz J, Brydak L,
Machala M, Landowski J, Mysliwski A. Immune
consequences of the spontaneous pro-inflammatory status in
depressed elderly patients. Brain Behav Immun 2004; 18: 135-48.
26 Lieb W, Pawlik R, Erdmann J, Mayer B,
Holmer SR, Fischer M, Baessler A,
Hengstenberg C, Loewel H, Doering A,
Riegger GA, Schunkert H. No association of interleukin-6
gene polymorphism (-174 G/C) with myocardial infarction or
traditional cardiovascular risk factors. Int J Cardiol 2004; 97:
205.
27 Adams D, Shaw S. Leucocyte-endothelial interactions
and regulation of leukocyte migration. Lancet 1994; 343: 831.
28 Zhou X, Stermme S, Hansson G. Evidence for a
local immune response in atherosclerosis. CD4+ T cells infiltrate
lesions of Apolipoprotein-E deficient mice. Am J Pathol 1996; 46:
359.
29 Huber SA, Sakkined P, Conze D, Tracy HR.
Interleukin-6 exacerbates early atherosclerosis in mice.
Atherioscler Thromb Vasc Biol 1999; 19: 2364-7.
30 Paoletti R, Gotto AM, Hajjar DP. Inflammation
in atherosclerosis and implications for therapy. Circulation 2004;
109(suppl III): 20.
31 Mazzolai L, Duchosal MA, Korber M,
Bouzourene K, Aubert JF, Hao H, Vallet V,
Brunner HR, Nussberger J, Gabbiani G, Hayoz D.
Endogenous angiotensin II induces atherosclerotic plaque
vulnerability and elicits a Th1 response in ApoE-/- mice.
Hypertension 2004; 44: 27.
32 Schieffer B, Schieffer E, Hilfiker-Kleiner D,
Hilfiker A, Kovanen PT, Kaartinen M,
Nussberger J, Harringer W, Drexler H. Expression of
Angiotensin II and Interleukin 6 in Human Coronary Atherosclerotic
Plaques. Potential Implications for Inflammation and Plaque
Instability. Circulation 2000; 101: 1372.
33 Schieffer B, Bünte C, Witte J, Hoeper K,
Böger RH, Schwedhelm E, Drexler H. Clinical
research: anti-inflammatory therapy in coronary artery disease.
Comparative effects of AT1-antagonism and angiotensin-converting
enzyme inhibition on markers of inflammation and platelet
aggregation in patients with coronary artery disease. J Am Coll
Cardiol 2004; 44: 362.
34 Grothusen C, Bley S, Selle T,
Luchtefeld M, Grote K, Tietge UJ, Drexler H,
Schieffer B. Combined effects of HMG-CoA-reductase inhibition
and renin-angiotensin system blockade on experimental
atherosclerosis. Atherosclerosis 2005; 182: 57-69.
35 Sattler KJ, Woodrum JE, Galili O,
Olson M, Samee S, Meyer FB, Zhu XY,
Lerman LO, Lerman A. Concurrent treatment with
renin-angiotensin system blockers and acetylsalicylic acid reduces
nuclear factor kappa B activation and C-reactive protein expression
in human carotid artery plaques. Stroke 2005; 36: 14.
36 Kinlay S, Schwartz GG, Olsson AG,
Rifai N, Leslie SJ, Sasiela WJ, Szarek M,
Libby P, Ganz P, Myocardial Ischemia Reduction with
Aggressive Cholesterol Lowering (MIRACL) Study Investigators.
High-dose atorvastatin enhances the decline in inflammatory markers
in patients with acute coronary syndromes in the MIRACL study.
Circulation 2003; 108: 1560.
37 Wiklund O, Mattsson-Hulten L, Hurt-Camejo E,
Oscarsson J. Effects of simvastatin and atorvastatin on
inflammation markers in plasma. J Intern Med 2002; 251: 338.
38 Torres JL, Ridker PM. Clinical use of high
sensitivity C-reactive protein for the prediction of adverse
cardiovascular events. Curr Opin Cardiol 2003; 18: 836.
39 Mora S, Rifai N, Buring JE, Ridker PM.
Additive value of immunoassay-measured fibrinogen and
high-sensitivity C-reactive protein levels for predicting incident
cardiovascular events. Circulation 2006; 114(5): 381-7; [e-pub
ahead of print].
40 Cook NR, Buring JE, Ridker PM. The effect of
including C-reactive protein in cardiovascular risk prediction
models for women. Ann Intern Med 2006; 145: 21.
41 Tanne D, Benderly M, Goldbourt U, Haim M,
Tenenbaum A, Fisman EZ, Matas Z, Adler Y,
Zimmlichman R, Behar S. C-reactive protein as a predictor
of incident ischemic stroke among patients with preexisting
cardiovascular disease. Stroke 2006; 37: 1720.
42 Ridker PM, Rifai N, Stampfer MJ,
Hennekens CH. Plasma concentration of interleukin-6 and the
risk of future myocardial infarction among apparently healthy men.
Circulation 2000; 101: 1767.
43 Bermudez EA, Rafii N, Bering J,
Manson JE, Ridker PM. Interrelationships among
circulating interleukin-6, C-reactive protein, and traditional
cardiovascular risk factors in women. Atherioscler Thromb Vasc Biol
(ATVB) 2002; 22: 1668.
44 Bennet AM, Prince JA, Fei GZ, Lyrenas L,
Huang Y, Wiman B, Frostegard J, Faire U.
Interleukin-6 serum levels and genotypes influence the risk for
myocardial infarction. Atherosclerosis 2003; 171: 359.
|
Version imprimable
Version PDF
