ARTICLE
Auteur(s) :Carolina Figueroa1, Alexis
Peralta2, Luisa Herrera3, Pedro
Castro2, Andrea Gutiérrez2, Jorge
Valenzuela1,4, Juan C Aguillón2, Rodrigo
Quera1,4, Marcela A
Hermoso2
1Department of Internal Medicine, Gastroenterology,
Hospital Clínico Universidad de Chile, Santiago de Chile
2Immunology Disciplinary Program, Biomedical Sciences
Institute, Faculty of Medicine, Universidad de Chile, Santiago de
Chile
3Human Genetics Program, Biomedical Sciences Institute,
Faculty of Medicine, Universidad de Chile, Santiago de Chile
4Department of Gastroenterology, Clínica Las Condes.
Santiago de Chile, Chile
accepté le 27 Février 2006
The incidence of inflammatory bowel diseases (IBD), including
ulcerative colitis (UC), Crohn’s disease (CD), and indeterminate
colitis (IC) seems to be increasing throughout the world [1-9]
including in developing countries. There is evidence that the
incidence of IBD may also be rising in Chile [10, 11]. Although the
etiology of IBD is still unknown, its pathogenesis seems to be
multifactorial [9, 11]. It has been proposed that in genetically
predisposed individuals, IBD occurs as result of an inappropriate
immunological response to commensal intestinal microflora [12, 13].
In normal subjects, to avoid an excessive and uncontrolled immune
response, the gastrointestinal epithelial cells turn on molecular
recognition pattern receptors. In recent years, polymorphisms
affecting several genes involved in the innate immune response have
been identified among patients who have developed IBD [14-16]. Some
of the polymorphisms reported include NOD2/CARD15 mutations [17,
18]. This receptor belongs to a gene superfamily located on
chromosome 16 and expressed mainly in monocytes, dendritic cells,
intestinal epithelium and Paneth cells [12]. The NOD2/CARD15 gene
encodes a cytoplasmatic receptor involved in pathogen recognition,
which leads to intracellular nuclear factor κB (NFκB) mobilization
[14, 16].However, when NOD2/CARD15 is mutated, pathogen or
commensal recognition may lead to altered intracellular NFκB
levels. The gene polymorphisms that are most often associated with
IBD are Arg702Trp, Gly908Arg and Leu1007fsinsC, and their relative
and absolute incidence has varied according to the ethnicity of the
population studied [19-23]. These polymorphism variants have not
only been linked with the risk for developing CD, but also with the
disease phenotype, and especially, with aggressive disease
behaviors such as early presentation, stricture development, and a
predominant involvement of the ileum [24, 25].Toll-like receptors
(TLRs) also play an important role in the pathogen recognition
process and in the activation of the innate immune response [14,
16]. TLR4 is expressed mainly in macrophages, dendritic cells and
endothelial cells and, to a lesser extent, in the intestinal
epithelium. The TLR4 recognizes gram-negative bacterial
lipopolysaccharide leading to intracellular activation of NFκB and
its translocation to the nucleus where it regulates gene
transcription. TLR4 expression in intestinal epithelium is
increased in CD patients, and the allele 299Gly has been related
with risk of developing IBD and CD, in particular [23, 24, 26].To
date there have been no studies that have specifically evaluated
the frequency of NOD2/CARD15 and TLR4 gene polymorphisms in Chilean
or South-American IBD patients; we undertook this study therefore,
determinate the presence and prevalence of this gene mutation in
Chilean IBD patients.
Materials and methods
Patients
All patients included in this study came from families that had
been born in Chile over at least two consecutive generations.
Forty-four IBD patients, (22 with CD and 22 with UC) were included
and 20 healthy individuals. They were recruited from the
Gastroenterology Section of the University of Chile Clinical
Hospital and the Gastroenterology Section of Clínica Las Condes.
All had a well-established diagnosis of CD and UC, according to
current diagnostic criteria and had been followed for at least one
year. The location of involved bowel segment was defined by
endoscopy and imaging studies. Clinical and demographic
characteristics were recorded, including, age at diagnosis, gender,
family history, smoking habits (current smoking, history of past
smoking, and never smoked), disease behavior, disease location,
extra-intestinal manifestations, type of surgery, if any, and
response to treatment.
Genetic analyses
Blood samples were collected in tubes containing heparin and total
DNA was prepared from peripheral blood lymphocytes using the
Chomczynski method [27]. TLR4, Asp299Gly (896 A/G)
polymorphism was genotyped using PCR-RFLP analysis. The PCR primers
employed were: (5’ GATTAGCATACTTAGACTACTACCTCCATGGT 3’) and (5’
GATCAACTTCTGAAAAAGCATTCCCAC 3’). The underlined base in the forward
primer indicates the location of the altered nucleotide used to
create a NcoI (TLR4 Asp299Gly) restriction site. Following PCR
amplification, the 249 bp product was digested with 1 U of NcoI
restriction enzyme overnight at 37°C. After digestion, the A allele
consisted of one fragment of 249bp and the G allele consisted of
223 and 26 bp fragments. The missense mutation Arg702Trp was
genotyped by a PCR amplification of specific allele assay using two
allele-specific forward primers R702WWTF: 5’ ATCTGAGAAGGCCCTGCTCC
3’ for the wild-type allele and R702WMUTF: 5’ ATCTGAGAAGGCCCTGCTCT
3’ for the Arg702Trp mutant allele, in combination with a common
primer R702WR: 5’ CCCACACTTAGCCTTGATG 3’, in two separate PCR
reactions. The 3’-ends of the forward primers, were able to anneal
to regions that differed between the two alleles.
The missense mutation Gly908Arg created a restriction site for
HhaI and was genotyped by a PCR-RFLP method (5’ CCCAGCTCCTCCCTCTTC
3’ and 5’AAGTCTGTAATGTAAAGCCAC 3’). After digestion, the wild-type
Gly908 allele resulted in an intact 380 bp fragment, whereas the
RFLP profile of the Arg908 variant was characterized by two bands
of 138 bp and 242 bp. The cytosine insertion mutation was genotyped
by a PCR amplification of specific allele assay using two,
allele-specific forward primers L1007fsinsCWTF: 5’ CAGAAGCCCTCCTGCA
GGCCCT 3’ for the wild-type allele and L1007fsinsCMUTF: 5’
CAGAAGCCCTCCTGCAGGCCCCT 3’ for the L1007fsinsC mutant allele, in
combination with a common primer L1007fsinsCR: 5’
TCTTCAACCACATCCCCATT 3’, in two separate PCR reactions. The 3’-ends
of the forward primers, were able to anneal to regions that
differed between the two alleles. DNA fragments were resolved on
agarose gels and visualized by ethidium bromide staining.
Ethical approval
This study was conducted after review and approval of the Ethics
Committee of Hospital Clínico of the Universidad de Chile or
Clínica Las Condes, as appropriate, and each patient gave written
informed consent.
Statistics
All values were expressed as mean + SE. Comparisons of the
frequencies of NOD2/CARD15 and TLR-4 polymorphisms were made among
the CD and UC patients and healthy controls. The analyses of
association with the phenotype were performed by χ2 or Fischer’s
exact test where appropriate p values less than 0.05 were
considered statistically significant.
Results
Demographic and clinical characteristics of the CD and UC patients
are shown in tables 1, 2( Table
1 )( Table 2 ). There were more
women than men in both groups of patients. The demographic
characteristics of the control population were similar. The
prevalence of individuals with some Native American heritage was
similar in CD patients (55%), UC patients (62%) and healthy
controls (57%). In the CD group, the majority of patients (14
patients) had colonic involvement alone, five had terminal ileal
involvement, five had perianal, two had ileo-colonic, and one,
esophageal, disease. The majority (14 patients), exhibited an
inflammatory phenotype. Joint involvement was present in 10
patients. Twelve patients had never smoked. Only one CD patient had
a first degree relative with IBD, who had UC. Among the UC
patients, the majority (14 patients) had pancolitis. Articular
manifestations were reported by 10 and 10 patients were ex-smokers
(defined as patients who stopped smoking more than 6 months prior
to the diagnosis of IBD).
The three mutations analyzed in the gene NOD2/CARD15 were found
in four patients, three with CD and one with UC (table 3( Table 3 )). The 702Trp allele was found in two
patients with CD, both heterozygotes. One of these patients had
experienced the onset of CD when he was 19 years-old, and the other
featured ileocolonic involvement and a penetrating phenotype. The
1007fsinsC allele was found in only one heterozygous CD patient who
showed esophageal and colonic involvement with a stricturing
phenotype. Finally, the mutation Gly908Arg was found in one patient
with ulcerative pancolitis, who was heterozygous for the mutation.
None of the patients studied showed more than one NOD2/CARD15
polymorphic variant. None of the control individuals showed any
polymorphism.
The 299Gly allele of TLR4 was found in two patients, one with CD
with colonic and perianal disease and an inflammatory phenotype,
and the other had ulcerative pancolitis (table 4( Table 4 )). None of the control individuals showed
this TLR4 polymorph variant. None of patients with CD or UC showed
coexistence of any of the variants analyzed for NOD2/CARD15 and the
TLR4 coding genes.
Table 1 Clinical characteristics of the Crohn’s disease
patients
|
Patients
|
|
Male/Female
|
8/14
|
|
Age (years)
|
46.8 years (16-65)
|
|
Age at diagnosis (years)
|
41.6 years (14-65)
|
|
Disease duration before diagnosis (months)
|
40 months (1-216)
|
|
Familial IBD
|
n (%) 1(5)
|
|
Disease localization n (%)
|
|
Upper GI
|
1 (5)
|
|
Ileum
|
5 (23)
|
|
Colon
|
14 (64)
|
|
Perianal disease
|
5 (23)
|
|
Ileocolon
|
2 (9)
|
|
Disease pattern (%)
|
|
Inflammatory
|
14 (64)
|
|
Stricturing
|
5 (23)
|
|
Penetrating
|
5 (23)
|
|
Extra-intestinal manifestations n (%)
|
|
Articular
|
10 (45)
|
|
Skin
|
5 (23)
|
|
Ocular
|
2 (18)
|
|
Oral ulceration
|
5 (23)
|
|
Surgery n (%)
|
10 (45)
|
|
Smoking habits n (%)
|
|
Never
|
12 (55)
|
|
Current
|
5 (23)
|
|
Ex-smoker
|
5 (23)
|
Table 2 Clinical characteristics of Ulcerative Colitis
patients
|
Patients
|
|
Male/Female
|
9/13
|
|
Age (years)
|
37.8 years (19-67)
|
|
Age at diagnosis (years)
|
32 years (11-59)
|
|
Disease duration before diagnosis (months)
|
9 months
|
|
Familial IBD n(%)
|
0(0)
|
|
Disease Localization n (%)
|
|
Proctitis
|
2 (9)
|
|
Rectosigmoiditis
|
2 (9)
|
|
Left sided colitis
|
4 (18)
|
|
Pancolitis
|
14 (64)
|
|
Extra-intestinal manifestations n (%)
|
|
Articular
|
10 (45)
|
|
Skin
|
3 (14)
|
|
Ocular
|
0 (0)
|
|
Oral Ulcers
|
4 (18)
|
|
Surgery n(%)
|
3 (14)
|
|
Smoking habits n (%)
|
|
Never
|
8 (36)
|
|
Current
|
4 (18)
|
|
Ex-smoker
|
10 (45)
|
Table 3 NOD2/CARD15 genotypes and alleles
investigated
|
Mutation
|
N°
|
Diagnosis
|
Disease Pattern
|
Disease location
|
|
702Trp
|
1
|
CD
|
Early presentation, inflammatory
|
Colon
|
|
1
|
CD
|
Penetrating
|
Ileo-colonic
|
|
1007insC
|
1
|
CD
|
Stricturing
|
Upper GI and colon
|
|
908Arg
|
1
|
UC
|
|
Pancolitis
|
|
Total
|
4
|
|
|
|
Table 4 TLR4 alleles investigated
|
Mutation
|
N°
|
Diagnosis
|
Disease Pattern
|
Disease location
|
|
299Gly
|
1
|
CD
|
Inflammatory
|
Colon and perianal
|
|
1
|
UC
|
|
Pancolitis
|
|
Total
|
2
|
|
|
|
Discussion
This is the first study to determine the prevalence of NOD2/CARD15
and TLR4 gene mutations in Chilean patients with UC and CD.
Although the number of patients in this study is small, our results
confirm that, as in European populations, Chilean patients have a
low frequency of the allelic variants associated with IBD.
As the ethnic background of the Chilean population is
heterogeneous, as a result of the admixture of diverse racial
groups to an extent that might influence our results, the racial
heterogeneity of individuals involved in the present study was
evaluated by analyzing the distribution of the ABO blood group.
This analysis suggested that the percentage of individuals of
Native American or Amerindian heritage was similar in all
groups.
CD and UC are multifactorial diseases, symptomatic with variable
courses and outcomes, treatment of which is primarily symptomatic.
Some patients may develop complications and require surgery.
Although the etiology IBD remains unsolved, its initiation may be
related to an abnormal inflammatory response to enteric commensal
microflora, in genetically predisposed individuals [12]. This
interpretation supports the concept that genetic polymorphism may
be relevant as a prognostic tool. It is also important to identify
aberrant intracellular mechanisms involved in IBD pathogenesis as a
means of developing new therapeutic tools. Recent studies assign
roles to the pathogen recognition receptors and their mechanisms of
activation as fundamental effectors in the development of IBD [16].
Among these receptors are those coded by the NOD2/CARD15 and TLR4
genes. Accordingly, polymorphisms in these genes could be risk
factors for the development of IBD and could even determine disease
severity and location.
CD is a heterogeneous and polygenic disease. While the three
mutations of NOD2/CARD15 gene are more frequent in Caucasian
patients with CD than in Caucasian control subjects, these
mutations have not been observed [28], or are very rare [29], in
Asian, Arabic [30], and African patients [31]. In our study, three
(13.6%) of the 22 patients with CD analyzed for NOD2/CARD15 gene
had one of the three variants. The relative risk of developing CD
among those with these polymorphisms varies widely. In Northern
European populations, the risk attributable to the NOD2/CARD15 gene
diminishes when compared with others from the southern population.
Even within the same country there may be differences. Arnott et
al. reported that the risk of developing IBD, in relation to
NOD2/CARD15 gene mutations in patients from Edinburgh (Scotland),
was 11% compared with 27% in patients from Oxford (England) [32].
In a meta-analysis of 37 studies of variants of the NOD2/CARD15
gene in a Caucasian population, people carrying only one high risk
allele had 2.4-folds (95% CI: 2.00-2.86) increased odds of CD, and
the risk for those carrying two or more of the risk alleles had
17.1-fold (95% IC 10.7-27.2) compared to people without any
high-risk alleles [33]. The risk of developing CD is even more
variable among NOD2/CARD15 gene variants. The same analysis showed
that the risk of developing CD was 4.1 for the Leu1007fsinsC
variant (95% IC 3.2-5.2) compared with 2.2 for the Arg702Trp
variant (95% IC 1.8-2.6) and 3.0 for the variant Gly908Arg (95% IC
2.4-3.7) [24]. In the present study, two patients with CD had the
Arg702Trp variant and only one the Leu1007fsinsC variant. Thus, the
small number of patients included in this study does not allow us
to estimate the real risk of developing CD as a function of
variants of the NOD2/CARD15 gene.
One recent study described that the frequency of NOD2/CARD15
variants is similar in patients and controls, suggesting that these
variants do not seem to be a risk factor for developing UC [24].
Nevertheless, other studies have suggested that the NOD2/CARD15
gene can interact with the haplotype IBD5 (OCTN1/N2), thereby
increasing the risk of developing UC [34]. In our analysis, only
one patient with UC displayed any of the three variants (Gly908Arg)
for the NOD2/CARD15 gene; we have not evaluated the presence of
IBD5 haplotype mutations. NOD2/CARD15 variants influence the site
of the intestinal segment involved in CD, being more frequent in
patients with ileal involvement as compared to those with CD
limited to the colon.
A meta-analysis showed that the odds ratio for terminal ileal
involvement was 2.5 (95% IC 2.0-3.2) compared with 1.5 (95% IC
1.2-1.9) for colonic disease alone [24]. The association between
variants of NOD2/CARD15 and terminal ileal involvement can be
explained by the observation that the expression of NOD2 in the
intestinal epithelium is restricted mainly to Paneth cells, which
are more abundant in the ileum [12]. In our work, three patients
with CD had colonic involvement, one of these had associated ileal
disease. Our sample is too small to offer an explanation for the
low frequency of NOD2/CARD15 variants in patients with ileal
disease. Up to now, no study has evaluated the presence of
NOD2/CARD15 variants in a large number of patients with CD and
upper gastrointestinal involvement (i.e. esophageal, gastric,
duodenal or jejunal). Only one of our patients had esophageal
involvement, as well as colonic disease. NOD2CARD15 variants have
also been associated with an increased risk of developing
intestinal strictures and fistulas, which tend to have a slower
evolution [35]. In this study, of three patients with one or more
of the three NOD2/CARD15 variants studied, one had perforating
ileal disease and the other, colonic stricturing. NOD2/CARD15
variants have also been associated with more aggressive disease,
higher risk of requirement for surgical intervention and a younger
age at diagnosis. On the other hand, NOD2/CARD15 variants do not
seem to be associated with a higher frequency of extra-intestinal
manifestations or a differential response to infliximab treatment
[36]. Only one of three patients with this variant in this study,
had extra-intestinal manifestations, and this individual had not
received infliximab treatment; again the small number of patients
included in the present study does not allow us to determine
whether a relationship between NOD2/CARD15 gene mutations and the
CD phenotype among Chilean patients exists.
An association between IBD and the TLR4 polymorphism has been
suggested by several groups, however, its role as a genetic
predictor in IBD development and evolution seems less strong when
compared to NOD2/CARD15 variants [23, 37]. The most frequently
described TLR4 allele in IBD is the 299Gly. Brand et al. reported
that 14.2% and 14.7% of patients with CD were heterozygous for
Asp299Gly and Thr399Ile variants, respectively, as compared to
37.7% of patients who presented at least one NOD2/CARD15 mutation
[23]. In the present study, two patients, one with CD and one with
UC, presented the 299Gly allele. None of the control individuals
presented the polymorph allele. We did not evaluate the frequency
of the Thr399Ile polymorphism in the cases included here. The
299Gly variant has also been associated with a stricturing
phenotype [23]. However, the only CD patient that showed the 299Gly
allele, in this study, had a different clinical profile. Other
research groups have not found any association between TLR4
polymorphisms and risk of developing IBD [32]. These differences
might be related to the ethnic diversity of patients included in
the studies and the diagnostic criteria used.
The identification of NOD2/CARD15 and TLR4 gene polymorphisms
and their implications are an important contribution to our
understanding of the heterogeneity of IBD. A genetic study of IBD
could be a powerful tool that may help in the prediction of risk
factors for developing a more aggressive version of the disease.
The study of the different genetic alterations linked to IBD [38],
taken together, could facilitate diagnosis and prognosis of IBD and
may help in the management of individual patients with this
disease.
In conclusion, TLR4 and NOD2/CARD15 gene mutations may
contribute to the development and evolution of CD and UC in Chilean
patients with IBD. The TLR4 polymorphism Asp299Gly seems to play a
minor role in the population studied. It is evident however, that
other genetic and environmental factors play a role in the
development and evolution of IBD in this population. As the number
of patients studied was small, our next goal is to perform a
prospective, multicenter study to increase the power of our
conclusions. By following up each individual over a longer period
of time, we hope to develop better correlations between phenotype
and genotype [27, 34].
Acknowledgements
This work was supported by Fondecyt Grant # 1050451, Clinic
Research Support Office (OAIC) from the Hospital Clínico
Universidad de Chile and Biotoscana Laboratories. None of the
Institutions had any influence in the study design or on the
interpretation of the results. We thank Mrs. Nancy Fabres and
Patricia Catalán for their technical support
References
1 Loftus Jr. EV, Sandborn WJ. Epidemiology of
inflammatory bowel disease. Gastroenterol Clin North Am 2002; 31:
1.
2 Loftus Jr. EV. Clinical epidemiology of inflammatory
bowel disease: Incidence, prevalence, and environmental influences.
Gastroenterology 2004; 126: 1504.
3 Stonnington CM, Phillips SF,
Melton 3rd LJ, Zinsmeister AR. Chronic ulcerative
colitis: incidence and prevalence in a community. Gut 1987; 28:
402.
4 Rodrigo L, Riestra S, Nino P, Cadahia V,
Tojo R, Fuentes D, Moreno M, Gonzalez
Ballina E, Fernandez E. A population-based study on the
incidence of inflammatory bowel disease in Oviedo (Northern Spain).
Rev Esp Enferm Dig 2004; 96: 296.
5 Rose JD, Roberts GM, Williams G,
Mayberry JF, Rhodes J. Cardiff Crohn’s disease jubilee:
the incidence over 50 years. Gut 1988; 29: 346-51.
6 Sedlack RE, Whisnant J, Elveback LR,
Kurland LT. Incidence of Crohn’s disease in Olmsted County,
Minnesota, 1935-1975. Am J Epidemiol 1980; 112: 759.
7 Sonnenberg A. Geographic variation in the incidence of
and mortality from inflammatory bowel disease. Dis Colon Rectum
1986; 29: 854.
8 Munkholm P, Langholz E, Nielsen OH,
Kreiner S, Binder V. Incidence and prevalence of Crohn’s
disease in the county of Copenhagen, 1962-87: a sixfold increase in
incidence. Scand J Gastroenterol 1992; 27: 609.
9 Leong RW, Lau JY, Sung JJ. The epidemiology and
phenotype of Crohn’s disease in the Chinese population. Inflamm
Bowel Dis 2004; 10: 646.
10 Figueroa C, Quera R, Valenzuela J,
Jensen C. Enfermedad inflamatoria intestinal: experiencia de
Dos Centros. Rev Med Chil 2005; 133: 1295.
11 Podolsky DK. Inflammatory bowel disease (1). N Engl J
Med 1991; 325: 928.
12 Gutierrez O, Pipaon C, Inohara N,
Fontalba A, Ogura Y, Prosper F, Nunez G,
Fernandez-Luna JL. Induction of Nod2 in myelomonocytic and
intestinal epithelial cells via nuclear factor-kappa B activation.
J Biol Chem 2002; 277: 41701.
13 Beltrán C, Guerrero J, Castro P,
Peralta A, Figueroa C, Quera R, Valenzuela J,
Hermoso MA. Papel del sistema inmune en el desarrollo de las
enfermedades inflamatorias intestinales. Gastr Latinoam 2005; 16:
208.
14 Rosenstiel P, Fantini M, Brautigam K,
Kuhbacher T, Waetzig GH, Seegert D,
Schreiber S. TNF-alpha and IFN-gamma regulate the expression
of the NOD2 (CARD15) gene in human intestinal epithelial cells.
Gastroenterology 2003; 124: 1001.
15 Bonen DK, Cho JH. The genetics of inflammatory
bowel disease. Gastroenterology 2003; 124: 521.
16 Galleguillos L, Benavides E, Quintana JC,
Zúñiga A, Alvarez M, Diaz F, et al. Claves
clínicas para el diagnóstico de Enfermedad de Crohn. Gastroenterol
Latinoam 2005; 15: 334.
17 Hugot JP, Chamaillard M, Zouali H,
Lesage S, Cezard JP, Belaiche J, Almer S,
Tysk C, O’Morain CA, Gassull M, Binder V,
Finkel Y, Cortot A, Modigliani R,
Laurent-Puig P, Gower-Rousseau C, Macry J,
Colombel JF, Sahbatou M, Thomas G. Association of
NOD2 leucine-rich repeat variants with susceptibility to Crohn’s
disease. Nature 2001; 411: 599.
18 Hampe J, Cuthbert A, Croucher PJ,
Mirza MM, Mascheretti S, Fisher S, Frenzel H,
King K, Hasselmeyer A, MacPherson AJ,
Bridger S, van Deventer S, Forbes A,
Nikolaus S, Lennard-Jones JE, Foelsch UR,
Krawczak M, Lewis C, Schreiber S, Mathew CG.
Association between insertion mutation in NOD2 gene and Crohn’s
disease in German and British populations. Lancet 2001; 357:
1925.
19 Leong RW, Armuzzi A, Ahmad T, Wong ML,
Tse P, Jewell DP, Sung JJ. NOD2/CARD15 gene
polymorphisms and Crohn’s disease in the Chinese population.
Aliment Pharmacol Ther 2003; 17: 1465.
20 Report WP. Towards an integrated clinical, molecular and
serological classification of inflammatory bowel disease. In: World
Congress of gastroenterology, Montreal, Quebec, Canada, 2005.
21 Yamazaki K, Takazoe M, Tanaka T,
Kazumori T, Nakamura Y. Absence of mutation in the
NOD2/CARD15 gene among 483 Japanese patients with Crohn’s disease.
J Hum Genet 2002; 47: 469.
22 Cario E. Bacterial interactions with cells of the
intestinal mucosa: Toll-like receptors and NOD2. Gut 2005; 54:
1182.
23 Brand S, Staudinger T, Schnitzler F,
Pfennig S, Hofbauer K, Dambacher J, Seiderer J,
Tillack C, Konrad A, Crispin A, Goke B,
Lohse P, Ochsenkuhn T. The role of Toll-like receptor 4
Asp299Gly and Thr399Ile polymorphisms and CARD15/NOD2 mutations in
the susceptibility and phenotype of Crohn’s disease. Inflamm Bowel
Dis 2005; 11: 645.
24 Gazouli M, Mantzaris G, Kotsinas A,
Zacharatos P, Papalambros E, Archimandritis A,
Ikonomopoulos J, Gorgoulis VG. Association between
polymorphisms in the Toll-like receptor 4, CD14, and CARD15/NOD2
and inflammatory bowel disease in the Greek population. World J
Gastroenterol 2005; 11: 681.
25 Cummings JR, Jewell DP. Clinical implications of
inflammatory bowel disease genetics on phenotype. Inflamm Bowel Dis
2005; 11: 56.
26 Lakatos P, Lakatos L, Szalay F,
Willheim-Poli C, Osterrreicher C, Tulassay Z,
et al. Toll-like receptor 4 and NOD2/CARD15 mutations in
Hungarian patients with Crohn’s disease: Phenotype-genotype
correlations. World J Gastroenterol 2005; 11: 1489.
27 Chomczynski P, Mackey K, Drews R,
Wilfinger W. DNAzol: a reagent for the rapid isolation of
genomic DNA. Biotechniques 1997; 22: 550.
28 Inoue N, Tamura K, Kinouchi Y, Fukuda Y,
Takahashi S, Ogura Y, Inohara N, Nunez G,
Kishi Y, Koike Y, Shimosegawa T, Shimoyama T,
Hibi T. Lack of common NOD2 variants in Japanese patients with
Crohn’s disease. Gastroenterology 2002; 123: 86.
29 Guo QS, Xia B, Jiang Y, Qu Y, Li J.
NOD2 3020insC frameshift mutation is not associated with
inflammatory bowel disease in Chinese patients of Han nationality.
World J Gastroenterol 2004; 10: 1069.
30 Karban A, Atia O, Leitersdorf E,
Shahbari A, Sbeit W, Ackerman Z, Mualem R,
Levine A, Nesher S, Safadi R, Eliakim R. The
relation between NOD2/CARD15 mutations and the prevalence and
phenotypic heterogeneity of Crohn’s disease: lessons from the
Israeli Arab Crohn’s disease cohort. Dig Dis Sci 2005; 50:
1692.
31 Stockton JC, Howson JM, Awomoyi AA,
McAdam KP, Blackwell JM, Newport MJ. Polymorphism in
NOD2, Crohn’s disease, and susceptibility to pulmonary
tuberculosis. FEMS Immunol Med Microbiol 2004; 41: 157.
32 Arnott ID, Nimmo ER, Drummond HE,
Fennell J, Smith BR, MacKinlay E, Morecroft J,
Anderson N, Kelleher D, O’Sullivan M,
McManus R, Satsangi J. NOD2/CARD15, TLR4 and CD14
mutations in Scottish and Irish Crohn’s disease patients: evidence
for genetic heterogeneity within Europe? Genes Immun 2004; 5:
417.
33 Economou M, Trikalinos TA, Loizou KT,
Tsianos EV, Ioannidis JP. Differential effects of NOD2
variants on Crohn’s disease risk and phenotype in diverse
populations: a meta-analysis. Am J Gastroenterol 2004; 99:
2393.
34 McGovern DP, Van Heel DA, Negoro K,
Ahmad T, Jewell DP. Further evidence of IBD5/CARD15
(NOD2) epistasis in the susceptibility to ulcerative colitis. Am J
Hum Genet 2003; 73: 1465.
35 Smith BR, Arnott ID, Drummond HE,
Nimmo ER, Satsangi J. Disease location,
anti-Saccharomyces cerevisiae antibody, and NOD2/CARD15 genotype
influence the progression of disease behavior in Crohn’s disease.
Inflamm Bowel Dis 2004; 10: 521.
36 Vermeire S, Louis E, Rutgeerts P, De
Vos M, Van Gossum A, Belaiche J, Pescatore P,
Fiasse R, Pelckmans P, Vlietinck R, Merlin F,
Zouali H, Thomas G, Colombel JF, Hugot JP.
NOD2/CARD15 does not influence response to infliximab in Crohn’s
disease. Gastroenterology 2002; 123: 106.
37 McGovern D, Van Heel D, Ahmad T,
Negoro K, Travis S, Jewell D. Evaluation of a
genetic panel in the diagnosis of Crohn’s disease. 2005.
38 Franchimont D, Vermeire S, El Housni H,
Pierik M, Van Steen K, Gustot T, Quertinmont E,
Abramowicz M, Van Gossum A, Deviere J,
Rutgeerts P. Deficient host-bacteria interactions in
inflammatory bowel disease? The toll-like receptor (TLR)-4
Asp299gly polymorphism is associated with Crohn’s disease and
ulcerative colitis. Gut 2004; 53: 987.
|
Version imprimable
Version PDF