ARTICLE
Auteur(s) :, Zsofia Gyulai1, Gergely
Klausz1, Andrea Tiszai2, Zsuzsanna
Lénárt2, Izabella Tóth Kása3, János
Lonovics2, Yvette
Mándi1,*
1Department of Medical Microbiology and
Immunobiology, University of Szeged, Dóm tér 10, H-6720 Szeged,
Hungary
2First Department of Internal Medicine, University of
Szeged, Korányi fasor 8-10, H-6720 Szeged, Hungary
3Outpatient Clinic, Department of Dermatology, Kálvin
tér 5, H-6720 Szeged, Hungary
accepté le 16 Septembre 2004
Introduction
Helicobacter pylori induces gastric inflammation in virtually all
of the hosts colonized, and such gastritis increases the risk of
gastric and duodenal ulceration, distal gastric adenocarcinoma and
gastric mucosal lymphoproliferative disease. In contrast with
infections with other mucosal pathogens however, only a small
percentage of the persons carrying H. pylori ever develop clinical
sequelae. Investigations focused on the pathogenesis of H. pylori
infections have emphasized that the disease risk involves specific
and choreographed interactions between pathogen and host [1], which
in turn are dependent upon strain-specific bacterial factors and an
induced immune response in the host [2]. Locally, nonspecific
immunity and, most importantly, the production of proinflammatory
cytokines is stimulated by the bacterium. It is specifically the
contact of bacteria with the gastric epithelial cells that induces
the production of proinflammatory cytokines. The cytokines are
released from neighboring leukocytes, and further activation of
these effector cells occurs in both autocrine and paracrine ways,
the chemotactic effect of IL-8 attracting further leukocytes. It is
important that IL-8, which plays a key role in the development of
the disease, is also secreted by gastric epithelial cells; hence,
the role of this cytokine in the initiation, modulation and
maintenance of the gastrointestinal inflammatory responses is
crucial [3]. In addition to the bacterial virulence, host factors
also seem to be important in the outcome of the infection. For
instance, the intensity of the local cytokine response can
contribute to the development of mucosal destruction [2, 4]. We
reported earlier that significantly higher levels of TNF-α, IL-6
and IL-8 were to be found in antral biopsy specimens from duodenal
ulcer (DU) patients than in those from H. pylori-negative subjects
[5]. This prompted us to investigate the role of a genetic
predisposition to higher cytokine production in the pathogenesis of
DU disease.
Genetic polymorphisms within the promoter of the
inflammation-related cytokine genes are thought to influence the
expression of these cytokines, and there are numerous infectious
and noninfectious diseases in which these polymorphic changes have
been shown to correlate with disease susceptibility or outcome of
the disease [6].
The present study was conducted to examine any association
between TNF-α and IL-8 polymorphisms and the development of DU
disease in H. pylori-infected patients. The clinical importance of
the TNF-α gene -308 promoter/enhancer polymorphism is supported by
the fact that the rare allele TNF2 has direct effects on the
transcription of TNF-α [7-10]. A common variant of the IL-8 gene
promoter region (-251A) also tends to be associated with increased
IL-8 production [11, 12]. CD14, expressed on the surface of
monocytes and hepatic Kupffer cells, is the receptor for
lipopolysaccharide (LPS) [13], a cell wall component of
Gram-negative bacteria. Since the LPS receptor CD14 plays a crucial
role in the initiation of the cytokine cascade [13], we also sought
a possible correlation between the -159 C→T promoter polymorphism
of CD14 and the development of peptic ulcer. A single nucleotide
polymorphism (SNP) in the promoter region of the CD14 gene (C/T at
position -159) has been described [14]. TT homozygotes have
significantly higher serum levels of sCD14 [15]. TT genotype
frequencies have been found to be increased in Crohn’s disease [16]
and in myocardial infarction [17]. An association between a genomic
polymorphism within the CD14 locus and septic shock was recently
reported [18]. Karhukorpi et al. [19] observed a tendency to a
higher frequency of the CD14 TT genotype in DU patients as compared
with subjects without DU. It therefore appeared logical to
supplement our study with an investigation of CD14
polymorphism.
Patients and methods
Patients
Sixty-nine H. pylori-positive patients with DU were studied. The
project was approved by the Clinical Ethical Committee of the
Medical Faculty of the University of Szeged (Szeged, Hungary), and
informed consent was obtained from all of the patients. Multiple
biopsy specimens were taken during upper gastrointestinal endoscopy
from adjacent sites of the gastric antrum and corpus for histology.
In addition, the 13C-urea breath test (UBT) was carried
out. Only patients with H. pylori infection documented by histology
and with a positive 13C-UBT result were considered
eligible for the study.
Forty-seven H. pylori-positive blood donors without gastric or
duodenal disease served as controls. The status of infection with
H. pylori in these controls was determined by serology with a
commercial ELISA kit (HP IgG ELISA (Dia.Pro, Milan, Italy), and by
13C-UBT positivity.
The patient population comprised 30 men and 39 women, with a
mean age of 54.46 ± 1.19 years (28-77), whereas in the control
group there were 22 men and 25 women, with a mean age of 49.85 ±
1.82 years (24-73). The two groups matched with regard to age
(Mann-Whitney U p=0.0971) and sex (Fisher’s exact test p=0.8494).
All case subjects and controls were of Hungarian ethnic origin and
resided in Hungary.
Genotyping procedures
DNA was extracted from the peripheral blood of the patients and the
controls using a High Pure PCR Template Preparation Kit (Roche,
Mannheim, Germany) according to the manufacturer’s instructions.
The analysis of the polymorphisms was based on polymerase chain
reaction (PCR) techniques performed either in a thermal cycler
(GeneAmp PCR System 2700, Applied Biosystems, Foster City, CA, USA)
or in a light cycler (Roche Laboratories, Basel, Switzerland).
TNF-α. The G→A transition at position -308 in the promoter
region defines the rare allele 2 associated with an elevated
expression of TNF-α [10]. A single base change at the 3’ end of
primer A1 (underlined) was required for the formation of an NcoI
recognition sequence [20].The PCR primers were:
A1: 5’ AGGCAATAGGTTTTGAGGGCCCAT 3’ and
A2: 5’ TCCTCCCTGCTCCGATTCCG 3’
100 ng of genomic DNA was amplified using Taq DNA polymerase
(Fermentas, Vilnius, Lithuania) with 1.5 mM MgCl2 under
the following conditions: 94 oC for 3 min, followed by
36 cycles of 94 oC for 1 min, 60 oC for 1 min
and 72 oC for 1 min, with an extension at 72
oC for 5 min. The amplified product was digested with
NcoI and analyzed on a 12% polyacrylamide gel. Digestion confirmed
two alleles. Allele 1 gave two fragments, of 87 bp and 20 bp, while
allele 2 gave a single, 107 bp fragment.
IL-8. A single nucleotide T→A polymorphism at -251 nt relative
to the transcription start site, accompanied by increased IL-8
production, was typed by an amplification refractory mutation
system (ARMS) [11]. The allele-specific primers were:
5’ CCACAATTTGGTGAATTATCAAT 3’ (-251A) and
5’ CCACAATTTGGTGAATTATCAAA 3’ (-251T)
The consensus primer was 5’ TGCCCCTTCACTCTGTTAAC 3’, giving a
PCR product of 336 bp. In each reaction, a second set of primers
for exon 3 of the HLA-DRB1 gene (forward: 5’ TGCCAAGTGGAGCACCCAA
3’, reverse: 5’ GCATCTTGCTCTGTGCAGAT 3’, product size 796 bp) was
used as a control for PCR efficiency. Reactions were carried out
using the Advantage-GC cDNA polymerase mix and buffer (Clontech,
Palo Alto, CA, USA) under the following conditions: 96
oC for 120 s; four cycles of 96 oC for 35 s,
68 oC for 45 s, and 72 oC for 35 s; four
cycles of 96 oC for 35 s, 65 oC for 45 s, and
72 oC for 45 s; four cycles of 96 oC for 35
s, 62 oC for 45 s, and 72 oC for 55 s; ten
cycles of 96 oC for 35 s, 58 oC for 45 s, and
72 oC for 65 s; ten cycles of 96 oC for 35 s,
55 oC for 45 s, and 72 oC for 75 s; four
cycles of 96 oC for 35 s, 52 oC for 45 s, and
72 oC for 85 s; four cycles of 96 oC for 35
s, 50 oC for 45 s, and 72 oC for 90 s; and 72
oC for 5 min.
CD14. A genetic polymorphism within the promoter region of the
CD14 LPS receptor gene was identified using a rapid-cycle PCR with
fluorescent-labeled oligonucleotide hybridization probes on the
LightCycler instrument and subsequent fluorescent probe melting
point analysis [15]. This polymorphism consists of a single base
exchange (C→T) at position -159, resulting in an elevated
expression of the CD14 receptor molecule. PCR was performed in
disposable capillaries (Roche Diagnostics) in a reaction volume of
10 μL containing 20-80 ng of DNA, 0.5 μM of each of the primers
(forward: 5’ GGTGCCAACAGATGAGGTTCAC 3’; reverse: 5’
CTTCGGCTGCCTCTGACAGTT 3’), 1 μL of reaction buffer (Roche
Diagnostics), and 0.2 μM of each of the probes. The detection probe
specific for the T allele (5’ TTCCTGTTACGGCCCCCCT 3’) was labeled
at the 3’ end with fluorescein. The anchor probe (5’
GGAGACACAGAACCCTAGATGCCCTGCA 3’) was labeled with LightCycler Red
640 at the 5’ end and modified at the 3’ end by phosphorylation to
block extension. The PCR conditions were as follows: initial
denaturation at 95 oC for 120 s, followed by 60 cycles
of denaturation (95 oC for 0 s), annealing (55
oC for 10 s), and extension (72 oC for 10 s).
The melting curve consisted of one cycle at 95 oC for 0
s, 45 oC for 10 s, and then a temperature increase to 95
oC at 0.2 oC/s. The fluorescence signal was
monitored continuously during the temperature ramp and then plotted
against the temperature.
Statistical analysis
All statistical calculations were performed with the Graph-Pad
Prism statistical program. To compare the genotype frequencies,
χ2 tests were performed and Yates’ correction was
applied, resulting in corrected P values. Allelic frequencies were
compared by Fisher’s exact test. For comparison of age and sex
between the patients and the controls, the Mann-Whitney U test and
Fisher’s exact test was used. Statistical significance was taken at
the p=0.05 level. The relationship between the presence of
individual alleles and disease is presented as the odds ratio with
a 95% confidence interval (OR 95% CI). The genotype frequencies for
each polymorphism were tested for deviation from the Hardy-Weinberg
equilibrium by the χ2 test, with one degree of freedom
used.
Results
The genotype frequencies of the TNF-α, CD14 and IL-8 polymorphisms
in the control group did not deviate significantly from those
expected for the Hardy-Weinberg equilibrium, (χ2
=0.0123, p=0.911; χ2=0.0212, p=0.884; χ2
=2.4040, p=0.121, respectively). Among the DU patients, only the
IL-8 genotype frequency deviated significantly from that for the
Hardy- Weinberg equilibrium (χ2 =6.4375, p=0.011).
TNF-α polymorphism
The frequency distribution of the genotypes for the TNF-α gene
polymorphism studied is shown in table 1( Table
1 ). There was no significant difference in the
distribution of the TNF-α -308 G→A gene polymorphism between the H.
pylori-positive DU patients and the H. pylori-positive healthy
controls (χ2=3.805, p=0.149). Likewise, no significant
difference in the rate of carriage of the high-secreting allele was
seen between the two populations (p=0.071).
Table 1 Allele and genotype frequencies of the TNF-α
-308 gene polymorphism
|
H. pylori-positive DU patients
|
H. pylori-positive controls
|
|
n
|
%
|
n
|
%
|
|
Allele a
|
|
1
|
121
|
87.68
|
74
|
78.72
|
|
2
|
17
|
12.32
|
20
|
21.28
|
|
Genotype b
|
|
1/1
|
54
|
78.26
|
29
|
61.70
|
|
1/2
|
13
|
18.84
|
16
|
34.04
|
|
2/2
|
2
|
2.90
|
2
|
4.26
|
aFisher’s exact test: p=0.071.
bChi-square test: χ2=3.805, p=0.149.
CD14 polymorphism
The frequency distribution of the genotypes for the CD14 gene
polymorphism is presented in table 2( Table
2 ). A significant correlation between the presence of the
CD14 -159 C→T promoter polymorphism and the development of DU
disease was not observed in the H. pylori-positive populations
studied. No significant differences were found in either the
genotype frequency distributions (χ2=0.1916, p=0.908),
or the rate of carriage of the allele linked to high expression of
CD14 [15]. The T allele was found in 47.1% of the patients as
compared with 50.0% of the controls (p=0.689).
Table 2 Allele and genotype frequencies of the CD14
-159 gene polymorphism
|
H. pylori-positive DU patients
|
H. pylori-positive controls
|
|
N
|
%
|
n
|
%
|
|
Allele a
|
|
C
|
73
|
52.90
|
47
|
50.00
|
|
T
|
65
|
47.10
|
47
|
50.00
|
|
Genotype b
|
|
C/C
|
20
|
28.98
|
12
|
25.53
|
|
C/T
|
33
|
47.83
|
23
|
48.94
|
|
T/T
|
16
|
23.19
|
12
|
25.53
|
aFisher’s exact test: p=0.689.
bChi-square test: χ2=0.1916, p=0.098.
IL-8 polymorphism
( Figure 1 )
depicts representative results relating to the IL-8 genotyping. To
detect the nucleotide swap, ARMS was used. By means of the two,
allele-specific primers, the homozygote mutant (AA), and the
heterozygote (AT) and the homozygote TT variants (336 bp product)
were easily distinguishable. To monitor the effectiveness of the
PCR reaction, the HLA-DRB1 exon 3 gene was also demonstrated in
each case (product size: 796 bp).
The genotypic frequencies were significantly different in the H.
pylori-positive patient and healthy control groups (table 3)( Table 3 ). There was a significantly higher
frequency of the IL-8 -251 T/A heterozygote genotype in the
diseased group (45/69, 65.22% versus 17/47, 36.17%;
χ2=11.26, p=0.0008). Similarly, the rate of carriage of
the high-secreting allele (IL-8 A) was significantly different in
the two populations (51.45% among the DU patients versus 37.23% in
the healthy blood donor group; p=0.043, OR=1.7863, CI 95%:
0.23-0.95), although the numbers of homozygotes were low and not
dissimilar. Conversely, the prevalence of the IL-8 TT, wild-type
genotype was significantly lower in the DU patients.
Table 3 Allele and genotype frequencies of the IL-8
-251 gene polymorphism
|
H. pylori-positive DU patients
|
H. pylori-positive controls
|
|
N
|
%
|
n
|
%
|
|
Allele
|
|
|
|
|
|
T
|
67 a
|
48.55 a
|
59 a
|
62.77 a
|
|
A
|
71 a
|
51.45 a
|
35 a
|
37.23 a
|
|
Genotype
|
|
T/T
|
11 b
|
15.94 b
|
21 b
|
44.68 b
|
|
T/A
|
45 b
|
65.22 b
|
17 b
|
36.17 b
|
|
A/A
|
13
|
18.84
|
9
|
19.15
|
aFisher’s exact test: p=0.043, OR=1.7863, CI 95%:
0.23-0.95.
bChi-square test with Yates’ correction:
χ2=11.26, p=0.0008.
Discussion
Although there is evidence that H. pylori infection plays a crucial
role in the pathogenesis of DU, there is a striking difference
between the number of infected individuals and the number that go
on to develop ulcer. Among H. pylori-positive subjects, the
incidence of ulcer formation is 15-20% [21]. Hence, the progression
toward the disease appears to depend on the combined effects of the
bacterial pathogenicity and host factors. Environmental factors
such as diet or the use of NSAID may also interfere in the
progression toward the various diseases due to infection.
We demonstrated previously that in H. pylori-positive patients
with DU there was considerable local TNF-α, IL-6 and IL-8
production in gastric biopsy samples, but only IL-8 was produced in
a significantly higher amount by the peripheral white blood cells
as compared with non-DU patients [5]. This prompted us to
investigate whether SNP in the IL-8 promoter region could confer a
higher risk of ulcer development as compared with the polymorphisms
of the TNF-α gene.
Polymorphisms in the TNF-α gene have tentatively been associated
with an increased risk of gastric carcinoma [22]. In our study, no
significant connection was found between the TNF-α-308 polymorphism
and the development of DU in the H. pylori-positive subjects. There
are two possible explanations. First, the regulation of cytokine
protein expression is complex and multifactorial. This means that,
following induction, both transcriptional and translational
regulation and posttranslational protein processing are major steps
involved in protein expression. The TNF-308 polymorphism affects
TNF transcription in both a cell-type and a stimulus-specific
manner and this effect may even be dependent on the differentiation
states of the cell and the inducers [23]. Brinkman et al. [24]
found that there was no difference between the level of
transcription of the -308 A and -308 G alleles in LPS-stimulated
peripheral monocytes. Similar observations were reported by Stuber
et al. [25]. The TNF-α gene utilizes different sets of
transcriptional elements, and TNF-α protein expression is probably
not regulated exclusively at the transcriptional level determined
by the -308 site on the promoter. Secondly, even with a potentially
high TNF-producing ability, the -308 polymorphism of the TNF-α gene
may not pose a risk of ulcer development. This is in good
accordance with the finding in our previous study that there was no
increased TNF-α-producing ability among DU patients in general,
when whole blood cell cultures were investigated [5]. Kunstmann et
al. reported that a genotype change at position -308 of the TNF-α
promoter was significantly more frequent in H. pylori-positive
patients than in H pylori-negative patients [26]; this relationship
was significant only for DUs, and not for gastric ulcers. Thus, the
conflicting results might be caused by the differences between the
sample groups, as we investigated only H. pylori-positive subjects,
although possible differences in the characteristics of the Korean
and Hungarian populations should not be ruled out.
CD14 is one of the key molecules that mediate the effects of LPS
[13]. The promoter region polymorphism (-159C/T) in the CD14 gene
is functionally important for regulating CD14 levels [15]. Our
working hypothesis was that TT genotypes associated with an
increased CD14 expression, might confer susceptibility to DU in H.
pylori-infected patients, potentiating the effect of LPS to shift
the cytokine response toward TH1 [27].
H. pylori LPS is reportedly much less potent in eliciting
cytokines or chemokines than LPS from Salmonella enterica or
Escherichia coli [28]. However, it has recently been stated that H.
pylori LPS binds to CD14 on macrophages and stimulates the release
of IL-8 [29, 30]. No association between ulcer and CD14
polymorphism was evident in our study, however. The interaction of
bacterial components with different Toll receptors [31] may promote
cytokine signals and may also demand consideration. It is
noteworthy however, that in an in vitro study, the gastric mucosal
recognition of H. pylori was independent of Toll-like receptor 4
[32]. In contrast, another study suggested that TLR4 may play a
crucial role in the initiation of inflammatory responses to H.
pylori infection [33]. A further study with a larger sample size is
warranted to explore the role of TLR receptor polymorphisms in
DU.
A significantly higher frequency of the IL-8 AT genotype was
observed among the H. pylori-positive DU patients than among the H.
pylori-positive healthy subjects without gastrointestinal problems.
This genotype reflects a higher IL-8-producing ability [11, 12].
Conversely, the frequency of the TT genotype (with a relatively low
IL-8-producing potential) was significantly higher among the H.
pylori-positive, healthy non-DU subjects. This suggests the
possibility that a relative protection from DU disease is observed
in association with the TT genotype. This observation is consistent
with the results of Hamajima et al. [34], who concluded that H.
pylori-positive healthy individuals with the IL-8 -251 TT genotype
might display a milder inflammatory reaction. Among our patients,
there were only a few individuals who carried the AA genotype; it
is very likely that this reflects the relatively small number of
patients investigated to date. In our study, the association with
IL-8 was only explored at the level of a single SNP (-251 A/T) and
not at the level of the haplotype [12]. The higher incidence of the
-251 AT genotype with a concomitant higher IL-8-producing potential
[11, 12] highlights the importance of the genetic determination of
IL-8 production in H. pylori-induced DU. This is in good accordance
with our previously published finding that inducible IL-8 was
higher in patients with DU than in H. pylori-positive healthy
subjects [5]. IL-8 is a crucial cytokine in the pathogenesis of DU,
where not only the inflammatory cells, but also the gastric
epithelial cells themselves can be a source of IL-8 production [2,
3]. H. pylori-induced gastric inflammatory diseases are associated
with the massive recruitment of phagocytes, and particularly
neutrophils, to the gastric mucosa.
It is therefore tempting to speculate that a predisposition to a
higher IL-8 response to the same bacterial stimulus (i.e. H.
pylori) might also be a factor predisposing to ulcerative
processes. There was no such connection between the polymorphisms
of the TNF-α and CD14 genotypes. It appears highly likely that just
one polymorphism cannot determine the final outcome of H. pylori
infection. The use of genome-wide SNPs, to detect realistic effect
sizes will typically require thousands of individuals [35]. Our
pilot study involved 67 cases and 47 controls, and the conclusions
must therefore be considered only preliminary. However,
determination of the frequencies of IL-8 polymorphism in H.
pylori-induced diseases could be informative and provide further
evidence concerning the role of IL-8 in DU formation, thereby
suggesting the clinical value of this genotype assessment.
Acknowledgments
We thank Mrs. Györgyi Müller for expert technical assistance.
This work was supported by Hungarian Research Grant OTKA T
042455 and ETT 124/2003.
References
1 Lamarque DM, Peek Jr. R. Pathogenesis of
Helicobacter pylori infection. Helicobacter 2003: 8-21.
2 Crabtree JE. Role of cytokines in pathogenesis of
Helicobacter pylori-induced mucosal damage. Dig Dis Sci 1998; 43:
S46.
3 Crabtree JE, Farmery SM, Lindley IJD. Cag
A/cytotoxic strains of Helicobacter pylori and interleukin-8 in
gastric epithelial cells. J Clin Pathol 1994; 47: 945.
4 Rudnicka W, Andersen PA. Inflammation and host
response. Curr Opin Gastroenterol 1999; 15: S17.
5 Klausz G, Tiszai A, Tiszlavicz L, et al.
Local and peripheral cytokine response and CagA status of
Helicobacter pylori-positive patients with duodenal ulcer. Eur
Cytokine Netw 2003; 14: 143.
6 Bidwell J, Keen L, Gallagher G, et al.
Cytokine gene polymorphism in human disease: on-line databases,
Supplement 1. Genes Immun 2001; 2: 61.
7 Majetschak M, Flohe S, Obertacke U, et al.
Relation of a TNF gene polymorphism to severe sepsis in trauma
patients. Ann Surg 1999; 203: 207.
8 Mira JP, Cariou A, Grall F, et al.
Association of TNF2, a TNF-alpha promoter polymorphism, with septic
shock susceptibility and mortality - A multicenter study. JAMA
1999; 282: 561.
9 Wilson AG, Di Giovine FS, Duff GW. Genetics of
tumour necrosis factor-α in autoimmune, infectious, and neoplastic
diseases. J Inflamm 1995; 45: 1.
10 Wilson AG, Symons JA, McDowel TL,
McDevitt HO, Duff GW. Effect of a polymorphism in the
human tumor necrosis factor α promoter on transcriptional
activation. Proc Natl Acad Sci USA 1997; 94: 3195.
11 Hull J, Thomson A, Kwiatkowski D. Association
of respiratory syncytial virus bronchiolitis with the interleukin 8
gene region in UK families. Thorax 2000; 55: 1023.
12 Hull J, Ackerman H, Isles K, et al.
Unusual haplotypic structure of IL8, a susceptibility locus for a
common respiratory virus. Am J Human Genetics 2001; 69: 413.
13 Schütt C. Molecules in focus: CD14. Int J Biochem Cell
Biol 1999; 31: 545.
14 Heesen M, Kunz D, Rossaint R, Blömeke B.
Real-time PCR assay with fluorescent hybridization probes for rapid
genotyping of the CD14 promoter polymophism. Clin Chem 2000; 46:
1866.
15 Baldini M, Lohman IC, Halonen M,
Erickson RP, Holt PG, Martinez FD. A polymorphism in
the 5’ flanking region of the CD14 gene is associated with
circulating soluble CD14 levels and with total serum immunglobulin
E. Am J Respir Cell Mol Biol 1999; 20: 976.
16 Klein W, Tromm A, Griga T, et al. A
polymorphism in the CD14 gene is associated with Crohn disease.
Scand J Gastroenterol 2002; 37: 189.
17 Hubacek JA, Rothe G, Pitha J, et al.
C(-260)→T polymorphism in the promoter of the CD14 monocyte
receptor gene as a risk factor for myocardial infarction.
Circulation 1999; 99: 3218.
18 Gibot S, Cariou A, Drovet L, Rossignol M,
Ripoll L. Association between a genomic polymorphism within
the CD14 locus and septic shock susceptibility and mortality rate.
Crit Care Med 2002; 30: 969.
19 Karhukorpi J, Yan Y, Niemelä S, et al.
Effect of CD14 promoter polymorphism and H. pylori infection and
its clinical outcomes on circulating CD14. Clin Exp Immunol 2002;
128: 326.
20 Wilson AG, Giovine FS, Blakemore AIF,
Duff GW. Single base polymorphism in the human tumour necrosis
factor alpha gene detectable by NcoI restriction of PCR product.
Hum Mol Gene 1992; 1: 353.
21 Graham DY, Rakel RE, Fendrick AM, et al.
Scope and consequences pf peptic ulcer disease. How important is
asymptomatic Helicobacter pylori infection? Postgrad Med 1999; 105:
100; 105, 110.
22 Machado JC, Figueiredo C, Canedo P,
et al. A proinflammatory genetic profile increases the risk
for chronic atrophic gastritis and gastric carcinoma. Gastroenterol
2003; 125: 364.
23 Kroeger KM, Steer JH, Joyce DA,
Abraham LJ. Effects of stimulus and cell type on the
expression of the –308 tumour necrosis factor promoter
polymorphism. Cytokine 2000; 12: 110.
24 Brinkman BM, Zuijdeest D, Kaijzel EL,
Breedveld FC, Verweij CL. Relevance of the tumor necrosis
factor alpha (TNF alpha) –308 promoter polymorphism in TNF alpha
gene regulation. J Inflamm 1995; 46: 32.
25 Stuber F, Udalova IA, Book M, et al. –308
tumor necrosis factor (TNF) polymorphism is not associated with
survival in severe sepsis and is unrelated to lipopolysaccharide
inducibility of the human TNF promoter. J Inflamm 1995; 46: 3.
26 Kunstmann E, Epplen C, Elitok E, et al.
Helicobacter pylori infection and polymorphisms in the tumor
necrosis factor region. Electrophoresis 1999; 20: 1756.
27 D’Elios MM, Amedei A, Del Prete G. Host
response to Helicobacter pylori infection: the Th1 1 balance. Clin
Microbiol Infect 1999; 5: 42.
28 Muotiala A, Helander JM, Pyhala L,
Kosunen TU, Moran A. Low biological activity of
Helicobacter pylori lipopolysaccharide. Infect Immun 1992; 60:
1714.
29 Bliss Jr. CM, Golenblock DT, Keates S,
Linevsky JK, Kelly CP. Helicobacter pylori
lipopolysaccharide binds to CD14 and stimulates release of
interleukin-8, epithelial neutrophil-activating peptide 78, and
monocyte chemothactic protein 1 by human monocytes. Infect Immun
1998; 11: 5357.
30 Bhattacharyya A, Pathak S, Datta S,
Chattopadhyay S, Basu J, Kundu M. Mitogen-activated
protein kinases and nuclear factor-kappaB regulate Helicobacter
pylori-mediated interleukin-8 release from macrophages. Biochem J
2002; 368: 121.
31 Lien E, Ingalls RR. Toll-like receptors. Crit Care
Med 2002; 30: S1.
32 Bäckhed F, Rokbi B, Torstensson E, et al.
Gastric mucosal recognition of Helicobacter pylori is independent
of toll-like receptor 4. J Infect Dis 2003; 187: 829.
33 Schmausser B, Andrulis M, Endrich S,
et al. Expression and subcellular distribution of toll-like
receptors TLR4, TLR5 and TLR9 on the gastric epithelium in
Helicobacter pylori infection. Clin Exp Immunol 2004; 136: 521.
34 Hamajima N, Katsuda N, Matsuo K, et al.
High anti-Helicobacter pylori antibody seropositivity associated
with the combination of IL-8-251TT and IL-10-819TT genotypes.
Helicobacter 2003; 8: 105.
35 Marchini J, Cardon LR, Philllips MS,
Donnelly P. The effects of human population structure on large
genetic association studies. Nature genetics 2004; 36: 512.
|
Version imprimable
Version PDF
