ARTICLE
Auteur(s) :, Caroline Diveu, Anne-Hélène Lagrue Lak-Hal,
Josy Froger, Elisa Ravon, Linda Grimaud, Fabien Barbier, Jacques
Hermann, Hugues
Gascan*, Sylvie Chevalier
Inserm Unit 564, CHU d’Angers, 4 rue Larrey, 49033 Angers Cedex
01, France
accepté le 29 Septembre 2004
Introduction
A novel cytokine receptor displaying similarities to the gp130
signaling receptor, and called GPL for GP130- like receptor, or
GLM-R, has recently been described [1, 2]. It also displays some
degree of homology with LIFR, OSMR and the IL-12 receptor family
members. Four different isoforms, diverging in their carboxy
terminus ends, have been isolated. GPL contains a cytokine binding
domain with four conserved cysteines, a WSDWS motif, and a region
consisting of three fibronectin type III domain repeats. The
intracellular part of the longer isoform contains a proline-rich
region defining the box1 motif implicated in the interaction with
the Janus kinases. Specific GPL transcripts were observed in
tissues involved in reproduction. Transcripts were also found in
blood cells and in bone marrow, revealing the expression of GPL in
all cells of the myelo-monocytic lineage, from hematopoietic stem
cells to activated dendritic cells. In monocytes and dendritic
cells, the expression of GPL was strongly up-regulated by IFN-γ,
indicating the possible involvement of GPL in Th1 type immune
responses.
The combination of different cytokine receptor components leads
to high affinity receptor complexes. The shared use of receptor
subunits has been used to classify and analyze the biological
functions of cytokines. Based on this notion, IL-2, IL-4, IL-7,
IL-9, IL-15, IL-21 were gathered to define the cytokine family
sharing the “γ chain” in the formation of their functional
receptors [3, 4]. Similarly, additional groupings of cytokines were
defined based on their common use of βc (IL-3, IL-5, GM-CSF) [5],
IL-4R (IL-4, IL-13) [6], IL-7R (IL-7, TSLP) [7] or IL-12Rβ1 (IL-12,
IL-23) [8-10].
The latest family of cytokines is known as the IL-6 family, and
encompasses in addition to IL-6, viral IL-6, IL-11, LIF, OSM, CNTF,
CT-1, CLC, neuropoietin (NP) and IL-27. All share the common gp130
signaling subunit in their multimeric receptors [11, 12]. Depending
on the activating ligand, gp130 can either homo-dimerize in the
presence of IL-6 or IL-11 [13, 14], or associate with a related
type I cytokine receptor, LIF receptor (LIFR) [15], when recruited
by LIF, OSM, CNTF, CT-1, CLC or NP [16-20]. OSM and IL-27 can also
activate specific receptors, implicating the OSM receptor (OSMR) or
the IL-27 receptor, respectively [12, 21, 22].
Using chimeric receptors, we have previously shown that the
internal part of GPL could hetero-dimerize with either LIFR or
gp130 to transduce a functional signal [1]. A recent study, based
on the use of similar chimeric receptors, demonstrated that the
internal portion of GPL could also cooperate with the equivalent
part of OSMR to deliver signaling information and recruit the STAT
signaling pathway [23]. More recently, the identification of IL-31
as a ligand for the GPL / OSMR receptor complex was reported. IL-31
is mainly produced by T cells and has an important immune function
in skin diseases [24].
In the present work, we analyze the signaling properties of
IL-31 in glioblastoma and melanoma tumor cells. We demonstrate that
in response to IL-31, its receptor complex recruits Jak1, Jak2,
STAT1, STAT3, STAT5 signaling pathways, as well as the Pi3-kinase /
AKT cascade. SHP-2 and Shc adapter molecules are also recruited and
contribute to an increased activation of the MAP kinase pathway in
response to IL-31. We studied the different biological responses
mediated by the short and long GPL receptor isoforms and show that
a short form of GPL receptor exerts a profound inhibitory effect on
the signaling of IL-31, and behaves as a dominant negative
receptor.
Materials and methods
Cells and reagents
Cos-7, HEK 293, glioblastoma, melanoma, myelomonocytic leukemia,
multiple myeloma, hepatoma, pulmonary, prostatic and mammary cell
lines were cultured in RPMI medium 1640 supplemented with 10% fetal
calf serum. BA/F3 gp130/OSMR and BA/F3 gp130/OSMR/GPL
factor-dependent cell lines were grown in the same culture medium
supplemented with OSM and IL-31, respectively. Human recombinant
OSM, IL-6, IL-5, soluble IL-6R, anti-OSM and anti-STAT5B antibodies
were purchased from R&D Systems (Oxon, UK). Gp130-Fc purified
fusion protein was kindly provided by Dr. K.J. Kallen (Kiel,
Germany). The anti-OSMR antibody (XR-M70) and the OSMR-Fc construct
were kindly provided by Dr. B. Mosley (Immunex, Seattle, WA, USA).
Other Fc fused soluble receptors, human recombinant LIF, anti-gp130
(AN-HH1) and IgG1 isotype control antibodies were produced in the
laboratory. The polyclonal anti-GPL antibody was raised by
immunizing rabbits with a 15-mer peptide chosen in the AB loop of
the receptor as previously described [1]. Antibodies raised against
phospho-STAT1, STAT1, phospho-STAT3, phospho-MAPK, MAPK,
phospho-AKT, AKT and phosphotyrosine (4G10) were bought from
Upstate Biotechnology (Lake Placid, NY, USA). Anti-STAT3, SHP-2,
Jak1, Jak2, Pi3-kinase antibodies were from Santa Cruz
Biotechnology (Santa Cruz, CA, USA). The anti-V5 antibody coupled
to peroxidase and the anti-Shc antibody were purchased from
Invitrogen (Carlsbad, CA, USA) and Transduction Laboratories
(Lexington, KY, USA), respectively. Goat anti-mouse and anti-rabbit
peroxidase labeled immunoglobulins were from Clinisciences
(Montrouge, France).
Cell transfection and proliferation assays
BA/F3 cell lines stably expressing with gp130 and OSMR were
transfected with cDNA encoding the long form GPL by electroporation
(960 microfarads and 230V). Cells were selected by growing in the
presence of 150 μg/mL zeocin (Invitrogen, Carlsbad, CA, USA). For
proliferation assays, transfected BA/F3 cells were seeded in
96-well plates at 5 x 103 cells per well in RPMI medium
1640 containing 5% fetal calf serum. Serial dilutions of cytokines
were performed in triplicates. After a 72-h incubation, 0.5 μCi of
3H thymidine was added to each well for the last four
hours of the culture and the incorporated radioactivity determined
(Packard Topcount luminometer, Meriden, CT, USA). Cos-7 cells were
transfected using the DEAE-dextran method. Seventy-two hours after
transfection, cells were deprived of serum and stimulated with the
indicated cytokines. A375 melanoma and U87MG glioblastoma cell
lines were transfected with the cDNA encoding the GPL long form and
the GPL short form using the Exgen transfection reagent (Euromedex,
Souffelweyersheim, France), respectively. Seventy-two hours after
transfection, cells were deprived of serum and were stimulated with
cytokines.
Cloning, expression and purification of IL-31
Total RNAs were isolated from human peripheral blood lymphocytes
after a six-hour activation with 10 nM PMA, 0.5% PHA using TRIzol
reagent (Invitrogen, Carlsbad, CA, USA). Full-length IL-31 cDNA was
PCR amplified and cloned into the pcDNA3.1D/V5-His-TOPO vector
(Invitrogen, Carlsbad, CA, USA) according to the available sequence
(accession number AY499343) [24]. The resulting cDNA was fused to
two sequences encoding the V5 and histidine hexamer tags to allow
protein detection and purification. For IL-31 production, the HEK
293 cell line was stably transfected with IL-31-V5-His
pcDNA3.1D/TOPO plasmid using the Exgen transfection reagent
(Euromedex, Souffelweyersheim, France). IL-31 was affinity purified
using Ni+ beads. Purified fractions were next submitted to SDS/PAGE
silver staining and Western blotting analysis.
RT-PCR analyses
cDNAs were synthesised from 2 μg of total RNA by random hexamer
primers using MMLV reverse transcriptase (Promega, Madison, WI,
USA). Reverse transcription products were subsequently amplified by
35 cycles of PCR using the following primers: TGGAGTCCCTGAAACGAAAG
(sense), TTAGACTTCTCCCTTGGTGTGC (anti-sense) for long form GPL,
GACCAAGGTGGAGAACATTGG (sense), CTTCAGGTTTAGCTTATCTTGGG (anti-sense)
for short form GPL and by 25 cycles of PCR using the following
primers: CCTGCCTACCTGAAAACCAG (sense), ACATTGGTGCCTTCTTCCAC
(anti-sense) for OSMR, ACCACAGTCCATGCCATCAC (sense),
TCCACCACCCTGTTGCTGTA (anti-sense) for GAPDH. Amplified products
were analysed by 2% agarose gel electrophoresis.
Site-directed mutagenesis
The pcDNA3.1 vector containing the cDNA encoding long form GPL was
subjected to site-directed mutagenesis using the
QuickChangeTM site-directed mutagenesis kit (Stratagene,
La Jolla, CA, USA) following the manufacturer’s instructions. The
three intracellular tyrosines in positions 652, 683 and 721 were
alanine substituted. Introduced mutations were verified by DNA
automatic sequencing. The receptor-Fc expression constructs
contained cDNAs encoding the extracellular portions of receptors
cleaved, by site-directed mutagenesis, before their transmembrane
domains and fused to the amino acid sequence of the Fc portion of
human IgG1. Fc fusion proteins were expressed in Cos-7 cells, and
the culture supernatants were used for the precipitation
experiments.
Tyrosine phosphorylation, immunoprecipitation and Western blot
analyses
After a thirty-six-hour serum starvation, cells were stimulated for
10 min in the presence of the indicated cytokines. Cells were lysed
in SDS sample buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 10%
glycerol, 50 mM DTT, 0.1% bromophenol blue), sonicated and then
submitted to SDS-PAGE and transferred onto an Immobilon membrane.
The membranes were subsequently incubated overnight with the
primary antibody before being incubated with the appropriate
peroxidase-labelled secondary antibody for 60 min. The reaction was
visualised by chemiluminescence according to the manufacturer’s
instructions (Amersham Biosciences, Les Ullis, France). Membranes
were stripped in 0.1 M glycine, pH 2.8 for two hours and
neutralized in 1 M Tris-HCl, pH 7.6 before reblotting. For
immunoprecipitation experiments, cells were lysed after activation
in 10 mM Tris HCL, pH 7.6, 5 mM EDTA, 50 mM NaCl, 30 mM sodium
pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate,
protease inhibitors and 1% Brij 96 detergent. After lysis and
centrifugation to remove cell debris, the supernatants were
immunoprecipitated overnight. Complexes were then isolated using
beads coupled to protein A and treated as described above. For
co-precipitation experiments, the soluble receptors fused to an
immunoglobulin Fc portion were incubated in the presence of
indicated cytokines for 16 h at 4°C, before being
immunoprecipitated with protein A beads. The samples were then
treated as described above.
Reporter gene assay
Transient transfection of GO-G-UVM cells was carried out in 24-well
culture plates using the Exgen transfection reagent (Euromedex,
Souffelweyersheim, France). The cells were transfected with 300 ng
of reporter gene as described previously [25]. Forty-eight hours
after transfection, the cells were starved before being incubated
with 50 ng/mL of the different cytokines for an additional sixteen
hours. Transfected cells were washed twice with cold PBS, and 100
μL of lysis buffer (0.1 M KH2PO4, pH 7.8, 0.1% Triton X-100) were
added to the wells. The extracts were then used directly to measure
the luciferase activity using a Packard Topcount luminometer
(Meriden, CT, USA).
Results
IL-31 expression and receptor subunit recruitment
IL-31 cDNA was PCR amplified from human peripheral blood cells
treated with a phorbol ester and PHA for six hours, and the
resulting cDNA was inserted into the pcDNA3.1D/V5-His-topo vector.
The cytokine was expressed as a tagged protein and purified from
culture supernatants of HEK 293 tranfected cells. SDS-PAGE gels and
Western blot analyses showed that the polypeptide had a MW of 29
kDa, corresponding, after subtracting the tag molecular weight, to
a mature protein of 24 kDa ( (figure 1A) ). We
controlled the functionality of the expressed protein by using
derivatives of the IL-3-dependent Ba/F3 cell lines rendered
responsive to cytokines of the IL-6 family by transfection with the
appropriate receptor chains ( (figure 1B) ). Ba/F3 cells
expressing gp130 and OSMR proliferated in response to OSM, but not
to IL-31. In contrast, the cells co-expressing GPL together with
gp130 and OSMR were able to proliferate in response to both OSM and
IL-31. The results obtained were in agreement with recently
published data characterizing IL-31 and its receptor complex [24].
Furthermore, the addition of an anti-OSMR antibody to the cultures
abrogated the proliferation of the Ba/F3 cell line in response to
IL-31, whereas no inhibition was observed upon addition of an
anti-gp130 antibody in control experiments. These results confirm
the involvement of the OSMR as a signaling subunit in the IL-31
receptor ( (figure
1C) ).
To identify subunit(s) directly contacting IL-31, we expressed
external portions of gp130, OSMR and GPL as Fc fusion proteins in
Cos-7 cells. After adding IL-31 or OSM, receptors were
immunoprecipitated with protein A beads. The purified fractions
were assayed by Western blotting using an anti-OSM antibody or an
anti-V5 tag antibody to respectively detect OSM and IL-31 receptor
associations ( (figure
2) ). As previously reported, OSM directly bound gp130 but
not OSMR [16, 26]. In contrast, GPL behaved as a binding subunit
for IL-31, whereas OSMR alone failed to recognize the cytokine.
Increased IL-31 binding was noted when OSMR was combined with GPL.
CD40-Fc fusion protein was used as an irrelevant receptor.
IL-31 activates the Jak / STAT pathway
We next analyzed the implication of Jak kinases in receptor
activation using the GO-G-UVM glioblastoma cell line that expresses
GPL receptor as well as OSMR and gp130 on its surface [1]. A
ten-min treatment of cells with IL-31 or OSM led to an activation
of both Jak1 and Jak2 signaling molecules ( (figure 3) ). We failed to
detect any activation of Jak3 in the GO-G-UVM cell line, which is
in agreement with the specific recruitment of Jak3 in cells of
immune origin. In contrast, a strong auto-active Tyk2 signal was
observed (data not shown), even after a long starvation culture
period, precluding the study of Tyk2 activation by IL-31 in the
GO-G-UVM cell background.
Once activated, Jaks are known to stimulate the phosphorylation
of downstream signaling molecules. Therefore, STAT signaling
pathways were analyzed in response to IL-31 in the GO-G-UVM cell
line. As shown in ( figure 4A-C ), IL-31
induced activation of STAT1, STAT3 and STAT5B. Similar responses
were observed for OSM as previously reported [27, 28]. The
signaling capacity of the OSMR subunit was further underlined by
showing that addition of an anti-OSMR monoclonal antibody to the
cultures led to a complete neutralization of the STAT3 response (
(figure 4D) ).
The reciprocal experiment using an anti-GPL antibody could not be
performed since neutralizing mAb for this receptor subunit are not
yet available.
The transcriptional activity of STAT3 in response to IL-31 was
then studied. For this, GO-G-UVM cells were transfected with a
reporter construct containing three STAT3 consensus binding sites
located upstream of a thymidine kinase minimal promoter [25].
Forty-eight hours post-transfection, the cells were serum-starved
and stimulated for an additional 16 h with saturating
concentrations of IL-31 or OSM. A 3-4-fold increase in luciferase
expression was induced by IL-31, as well as by OSM ( (figure 4E) ). Altogether,
these data indicate that IL-31 recruits STAT3 for both signaling
and transcriptional activation of target genes.
Involvement of SHP-2 and Pi3-kinase / AKT pathway in IL-31
signaling
The tyrosine phosphatase SHP-2 is known to be recruited into the
tyrosine kinase signaling pathway via its binding to
phosphotyrosine motifs expressed by signaling receptor chains [29,
30]. IL-31 was found to induce the tyrosine phosphorylation of
SHP-2, as previously reported for OSM and LIF [27]( (figure 5A) ). It is also
known that SHP-2 can regulate the gp130 signaling cascade by
recruiting the Pi3-kinase / AKT pathway [31]. We therefore
investigated the possibility that the OSMR / GPL receptor complex
could similarly recruit Pi3-kinase ( (figure 5B) ). Whereas OSMR
/ gp130 induced a robust phosphorylation of Pi3-kinase upon
stimulation with OSM, a slight but significant increase in the
tyrosine phosphorylation level of the kinase was observed after
activation of the OSMR / GPL complex by IL-31. ( Figure 5C ) shows that, in
contrast, IL-31 led to a marked increase in the tyrosine
phosphorylation level of AKT, similar to that observed when
treating the cells with OSM.
IL-31 induces activation of the MAP kinase pathway
In addition to the Pi3-kinase / AKT activation pathway, SHP-2 is
also known to associate with the GRB2 / Sos adapters and regulate
the MAP kinase pathway [32-34]. The ERK1 / ERK2 MAP kinases have
been shown to play important roles in mediating the mitogenic
effects of the IL-6 family members [35]. ERK1/2 activation was
determined by measuring their tyrosine phosphorylation levels.
Stimulation of the glioblastoma cell lines with IL-31 quickly
increased the MAP kinase phosphorylation after a 10-min contact
with the cytokine ( (figure 6A) ), before
returning to basal levels after a 30-40-min period (data not
shown). These results demonstrate activation of the MAP-kinase
signaling pathway in functional responses to IL-31. Involvement of
the MAP kinase pathway was previously studied in detail for
cytokines of the IL-6 family by comparing the response mediated by
the LIF receptor complex (gp130/LIFR) versus the OSM receptor
complex (gp130/OSMR) [36-38]. It turned out that the OSM receptor
complex was a much more potent activator of the Shc adapter and of
the ERK1/2 cascade [29, 30]. Since OSMR is a constituent of the
IL-31 receptor complex, we analyzed the possibility that the
cytokine could activate Shc, and hence reinforce the specificity of
the IL-31 response compared to other IL-6-type cytokines. A strong
signal, similar to that obtained with OSM, was demonstrated ( (figure 6B) ). Despite
consistent surface expression of LIFR subunit, LIF failed to
recruit Shc in a significant manner, as previously reported [38].
Collectively, these data reinforce the fact that both OSMR / gp130
and OSMR / GPL are major pathways for recruitment of the MAP kinase
signaling cascade.
The short form of GPL receptor is a dominant negative
receptor
During the course of this work, we observed some discrepancies
between the cell surface co-expression of OSMR and GPL receptor,
and IL-31 responsiveness. A number of cell lines studied expressed
both receptor subunits but failed to respond to IL-31, as tested by
analyzing the induction of STAT3 phosphorylation (table 1( Table 1 ) and below). We previously identified
different isoforms of the GPL receptor, differing in their
intracytoplasmic region. A long isoform receptor containing 745
residues and a short form of 560 amino-acids, that only contains
three intracellular residues were predominantly expressed in cell
lines and tissues [1]. Therefore, we decided to analyze in detail
the involvement of short and long GPL isoforms in IL-31 signaling.
Cos-7 cells expressing endogenous gp130 and OSMR, but not GPL, were
used as recipient cells to reconstitute functional IL-31 receptor.
After transfection with the long or short isoforms of GPL, cells
were incubated in the presence of IL-31, or OSM used as a positive
control. STAT1 and STAT3 activation levels were analyzed by Western
blot. As shown in ( figure 7 ), stimulation of
Cos-7 expressing endogenous gp130 and OSMR with OSM, elicited STAT1
and STAT3 activation, which was not the case with IL-31 treatment.
Introduction of the full length GPL receptor isoform into Cos-7
cells allowed the reconstitution of a functional receptor for
IL-31. In contrast, expression of short form GPL did not lead to
STAT1 or STAT3 recruitment. This indicates that, at least, the Jak
binding box 1 deleted in the short form of receptor, and possibly
the GPL tyrosine residues, are required to recruit STAT signaling
pathway in response to IL-31.
To further analyze the information transduced by the GPL
receptor, each of the three tyrosine residues contained in the
intracellular portion of long isoform GPL were mutated. Tyrosine
residues were substituted by alanines, individually, by pairs or
all three together. Mutated receptors were then expressed in Cos-7
cells and activated using IL-31, or OSM as control cytokine ( (figure 8) ). Each
individual mutation led to only marginal decreases in STAT1 and
STAT3 protein activation. When the three tyrosine residues of GPL
were simultaneously mutated, a slight decrease in the STAT1 and
STAT3 recruitment was observed. Collectively, these data suggest
that the GPL receptor mostly contributes to the cross-activation of
OSMR, but is only poorly able to recruit the STAT pathway on its
own.
We further assessed the functionality of the IL-31 receptor
complex by studying the distribution of the short and long isoforms
of GPL in different human cell lines (( figure 9 ) and table 1).
For this purpose, we set up RT-PCRs specifically amplifying the two
receptor forms, although we have so far not been able to develop a
real time quantitative amplification. We therefore submitted RT
products to serial dilutions before amplification, to determine a
comparative estimate of short and long GPL isoforms (table 1).
Results revealed a differential distribution of GPL isoforms
depending on the cell line tested. Some of the cell lines, such as
A375 melanoma, displayed co-expression of both isoforms, whereas
the U87MG glioblastoma cell line only expressed the long form of
the receptor. In contrast, the SK-BR-3 mammary tumor cell line only
expressed the short form GPL receptor.
As illustrated in ( figure 10A ), IL-31 was a
strong inducer of STAT3 tyrosine phosphorylation in the U87MG
glioblastoma cell line, whereas no recruitment of the signaling
protein could be demonstrated in the A375 melanoma cell line.
Increasing contact time and cytokine concentrations did not modify
the response observed in the A375 cells (( figure 10B ) and C).
Despite a co-expression of OSMR and GPL receptor in a number of
cell lines tested, only those expressing predominantly the long
isoform of GPL together with OSMR were able to elicit STAT3
tyrosine phosphorylation in response to IL-31 (table 1).
At this point, we hypothesized that the short GPL isoform could
behave as a dominant negative receptor by inhibiting the signaling
machinery mediated by the long form receptor. To test this
hypothesis, we co-expressed different ratios of the short and long
isoforms in Cos-7 cells and activated the cells with IL-31 ( (figure 11) ). Less
than a two-fold ratio in favor of the short form of the protein was
sufficient to strongly antagonize the long form signaling
receptor.
We next over-expressed the 745 amino acid long form of the
receptor in A375 cells and analyzed the tyrosine phosphorylation
level of STAT3 in response to OSM and IL-31 ( (figure 12B) ). Whereas the
response to OSM or to a combination of IL-6 and soluble IL-6
receptor remained unchanged, a clear induction of STAT3
phosphorylation was detected in the transfected cells. Reverse
experiments were carried out using the U87MG glioblastoma cell
line, which spontaneously expressed the long GPL isoform, but not
the short subtype, as shown above in ( figure 9 ). In this mirror
experiment, the 560 residue short form of receptor was transfected
in U87MG cell line and the STAT3 recruitment analyzed ( (figure 12D) ). A decrease
in the ability of IL-31 to recruit the STAT3 signaling pathway in
cells transfected with the short form receptor was clearly shown.
Collectively these results demonstrate that the 560 amino acid
short isoform of GPL receptor can counteract the signaling
machinery mediated by the long form of receptor. It also indicates
that the relative ratio of both receptor forms is an important
point to consider for analyzing the functional response to
IL-31.
Table 1 Expression of short and long isoforms of GPL
receptor in tumor cell lines. OSMR, short and long form of GPL were
studied by RT-PCR. Serial dilutions of cDNA were amplified to have
a semi-quantitative analysis of transcript expression level. -, no
detectable expression; +, low expression level; ++, predominant
expression level. Induction of STAT3 tyrosine phosphorylation in
response to IL-31 was determined by Western blot analysis
|
Tissue origin
|
Cell line
|
RT-PCR
|
STAT3 activation
|
|
OSMR
|
Long form GPL
|
Short form GPL
|
|
Myelomonocytic
|
U937
|
+
|
+
|
++
|
-
|
|
leukemia
|
THP1
|
-
|
+
|
+
|
-
|
|
Multiple myeloma
|
U266
|
-
|
-
|
-
|
-
|
|
Glioblastoma
|
A172
|
+
|
++
|
+
|
+
|
|
CCF-S-TTG1
|
+
|
+
|
++
|
-
|
|
GO-G-UVM
|
+
|
++
|
+
|
+
|
|
U87MG
|
+
|
++
|
-
|
+
|
|
Melanoma
|
A375
|
+
|
+
|
++
|
-
|
|
Hepatoma
|
HEPG2
|
+
|
-
|
-
|
-
|
|
Pulmonary tumor
|
A549
|
+
|
++
|
+
|
+
|
|
Prostatic tumor
|
DU145
|
+
|
++
|
+
|
+
|
|
Mammary tumor
|
MCF-7
|
+
|
+
|
++
|
-
|
|
SK-BR-3
|
-
|
-
|
+
|
-
|
Discussion
We and others previously reported the identification of an orphan
cytokine receptor named GPL, co-localizing with gp130 and
displaying a 28% identity rate with it [1, 2]. A recent paper has
shown its implication, together with OSMR, in the formation of the
functional receptor complex for a newly identified cytokine, IL-31
[24]. IL-31 is a cytokine preferentially produced by T helper type
2 cells. Mice modified to over-express IL-31 developed severe
pruritis, alopecia and skin lesions, indicating important immune
functions of IL-31 in skin diseases.
In the present study, we have analyzed the cell signaling
mechanisms triggered by IL-31 and compared the pathways recruited
with those activated by OSM. The present work underscores some
overlaps between the signaling cascades recruited by both IL-31 and
OSM. The function of the short form GPL receptor indicates a fine
tuning of the IL-31 response.
Usually, a cytokine binds preferentially to one of the subunits
of a multimeric receptor [39]. For the cytokines of the IL-6
family, it has been established that LIFR preferentially binds LIF
[16], whereas gp130 behaves as a converter subunit to allow
receptor dimerization and the subsequent signaling events. With
respect to OSM, this cytokine directly associates with gp130,
whereas in this case LIFR and OSMR play the function of converter
receptors for type I and type II OSM receptor complexes,
respectively [16, 26]. In the present study, we observed that IL-31
directly bound to GPL. No direct association of IL-31 with OSMR
could be demonstrated, suggesting that this latest subunit mainly
plays a role of converter in the IL-31 receptor complex. The
observation that a neutralizing anti-OSMR antibody could entirely
block the functional response of IL-31 further pointed out the
importance of the OSMR in cell signaling. Similarly, the
substitution of all tyrosine residues in the GPL intracellular
region only slightly affected the STAT signaling capacities of the
IL-31 receptor complex, indicating that the OSMR plays major role
in transmembrane signal transduction in response to IL-31. This was
recently confirmed by expressing synthetic receptor subunits made
of the external portions of the IL-5 receptor fused to the
intracellular portions of GPL and OSMR [23]. These receptor
chimeras can be artificially recruited by IL-5 and reveal some
information about the signaling potential of GPL / OSMR
heterochimeric complex. Dreuw et al. have shown that STAT3 and
STAT5 bind to tyrosine residues 721 and 652 of GPL, respectively.
They also report a marginal recruitment of STAT1 by the chimeric
receptor, and that GPL by itself was insufficient to recruit
ERK1/2, SHP-2 and Shc pathways.
To better understand the physiological responses of the GPL /
OSMR heterodimer to IL-31, native forms of receptors were analyzed
in the present study. A majority of the cell signaling experiments
was carried out using different glioblastoma cell lines that
express the 745 residue GPL long form [1]. We could show that
IL-31-activated receptor was able to recruit Jak1 and Jak2 kinases.
A spontaneous, high activation level of Tyk2 kinase in the cells
that we used hid the detection of a potential signal in response to
IL-31. The possibility of Tyk2 contributing to IL-31 signaling
remains open.
Following cell stimulation by IL-31 and JAK activation,
information is relayed to the nucleus by a number of signaling
molecules including the STATs [40]. Similarly to the data reported
very recently by Dillon et al. [24], we observed a consistent
activation of STAT1, STAT3 and STAT5B upon stimulation by IL-31 in
a number of cell lines tested as measured by analyses of STAT
phosphorylation levels and transcriptional activity of STAT3. We
notice that compared to STAT1, a preferential recruitment of STAT3
and STAT5 was reported by Dreuw et al. [23], likely reflecting
differences associated with the cell lines used and the expression
levels of intracellular signaling molecules.
The tyrosine phosphatase SHP-2 is a widely expressed protein,
which becomes tyrosine phosphorylated after cell stimulation with a
number of cytokines [31]. The gp130 family cytokines can recruit
SHP-2 phosphatase through phosphorylated gp130 Y759 to deliver
proliferative signals [29, 30]. SHP2 acts as a positive effector by
associating with the GRB2 adapter, leading to the activation of the
MAP kinase pathway [32]. Contact between Pi3-kinase and SHP-2 has
also been reported after activation by some IL-6 family cytokines,
or by thrombopoietin [33, 41]. In this work, we show that the IL-31
receptor complex is able to recruit SHP-2, which in turn leads to
activation of the Pi3-kinase / AKT pathway as well as to activation
of the ERK1/2 cascade.
The MAPK pathway is particularly favoured in the OSM response
compared to that observed for LIF or IL-6 [36-38]. This is due to
the fact that the OSMR subunit can strongly associate with the Shc
adapter through its Y861 residue and further reinforce the
recruitment of the whole MAP kinase cascade [29, 30]. In the
present work, we show that similarly to OSM, but not to LIF, IL-31
can also elicit a strong recruitment of the Shc adapter, which in
turn contributes to the activation of the MAP kinase pathway.
Shared, as well as distinct, biological properties have been
ascribed to OSM, LIF and IL-6. The fact that IL-31, like OSM, has a
much stronger potential in activating Shc, further underlines the
functional similarity between the two cytokines. Subtractive
strategies or micro-array analyses should contribute to delineate
similarities and differences between the functional responses to
OSM and IL-31.
In the experiments that were carried out initially, we observed
functional differences in the A375 melanoma cell line responses to
OSM and IL-31. The inhibition of A375 melanoma cell line growth by
OSM was used historically to identify and clone the gene encoding
OSM [42, 43]. Despite co-expression of GPL and OSMR subunits in
this cell line, we failed to detect any functional response to
IL-31, suggesting that additional mechanisms must regulate the
IL-31 response. Since we previously identified at least four
different GPL isoforms, with a predominant expression of a long
(745 residues) and a short (560 residues) subtype, we tested the
possibility that the short form receptor could behave as a dominant
negative receptor. Short form dominant negative receptors have
already been reported for several members of the cytokine receptor
family. This has been particularly well studied for a subset of
hormone receptors comprising this family of proteins, i.e.
prolactin, growth hormone and leptin. The short form of the leptin
receptor is marginally able to display a dominant negative role
[44]. In contrast, short forms of growth hormone and prolactin
receptors profoundly silenced their respective long form receptors
[45-48]. In the present work, we were able to show that the GPL
receptor long / short form ratio strongly conditioned the IL-31
functional response. Indeed, even a slight over-expression of the
short form of receptor (two-fold) can strongly antagonize the IL-31
signaling cascades. Consequently, a number of the cell lines tested
were insensitive to IL-31 treatment. Several hypotheses may explain
the neutralizing activity of the short subtype of receptors. For
the prolactin and growth hormone receptors, different interference
levels have been reported. Slight variations in the affinity of the
ligands for their cognate receptors have been observed [45]. These
also included the formation of inactive hetero-dimers that failed
to activate the JAK kinases [45-48]. An accumulation of
non-functional receptors on the cell surface due to the
non-internalization of short form receptors has also been reported
[46, 47]. Similarly, truncated or short form cytokine receptors are
usually more abundantly expressed at the cell surface [48]. This
was also noticed for OSMR the expression of which is improved after
a box1/2 region deletion [49]. For the thrombopoietin receptor, it
was recently demonstrated that a truncated subtype of receptor was
able to associate intracellularly with the signaling form of the
receptor and counteract its expression by increasing its lysosomal
degradation [50]. In the case of the IL-31 receptor complex, there
is a clear defect in the short form GPL receptor’s ability to
recruit the JAK/STAT pathway due to a lack of a box1 motif in its
sequence.
Primary observations reported the highest expression levels of
GPL in tissues involved in reproduction, in the myelo-monoctic
lineage, in spleen, thymus, lung, skin and trachea [1, 2, 24]. Most
of these tissues also express the OSMR suggesting they are
potentially IL-31 responsive. In the light of the present work, a
careful re-evaluation of GPL isoform tissue distribution should
lead to a better understanding of IL-31-mediated biological
functions.
Acknowledgements
C.D. was supported by grants from Angers Agglomeration and the
Société Française d’Hématologie. This study was supported by Grant
5176 from the Association pour la Recherche contre le Cancer, and
by the Post-Genome Program of the Région Pays de la Loire. We thank
Dr. C. Guillet and Dr. D. McIlroy for correcting the manuscript.
References
1 Diveu C, Lelievre E, Perret D, et al. GPL, a
novel cytokine receptor related to GP130 and leukemia inhibitory
factor receptor. J Biol Chem 2003; 278: 49850.
2 Ghilardi N, Li J, Hongo JA, Yi S,
Gurney A, De Sauvage FJ. A novel type I cytokine receptor
is expressed on monocytes, signals proliferation, and activates
STAT-3 and STAT-5. J Biol Chem 2002; 277: 16831.
3 Boulay JL, O’Shea JJ, Paul WE. Molecular
phylogeny within type I cytokines and their cognate receptors.
Immunity 2003; 19: 159.
4 Asao H, Okuyama C, Kumaki S, et al.
Cutting edge: the common gamma-chain is an indispensable subunit of
the IL-21 receptor complex. J Immunol 2001; 167: 1.
5 Miyajima A, Mui AL, Ogorochi T,
Sakamaki K. Receptors for granulocyte-macrophage
colony-stimulating factor, interleukin-3, and interleukin-5. Blood
1993; 82: 1960.
6 Zurawski SM, Vega Jr. F, Huyghe B,
Zurawski G. Receptors for interleukin-13 and interleukin-4 are
complex and share a novel component that functions in signal
transduction. EMBO J 1993; 12: 2663.
7 Pandey A, Ozaki K, Baumann H, et al.
Cloning of a receptor subunit required for signaling by thymic
stromal lymphopoietin. Nat Immunol 2000; 1: 59.
8 Trinchieri G. Interleukin-12 and the regulation of innate
resistance and adaptive immunity. Nat Rev Immunol 2003; 3: 133.
9 Oppmann B, Lesley R, Blom B, et al. Novel
p19 protein engages IL-12p40 to form a cytokine, IL-23, with
biological activities similar as well as distinct from IL-12.
Immunity 2000; 13: 715.
10 Parham C, Chirica M, Timans J, et al. A
receptor for the heterodimeric cytokine IL-23 is composed of
IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J
Immunol 2002; 168: 5699.
11 Hibi M, Murakami M, Saito M, Hirano T,
Taga T, Kishimoto T. Molecular cloning and expression of
an IL-6 signal transducer, gp130. Cell 1990; 63: 1149.
12 Pflanz S, Hibbert L, Mattson J, et al.
WSX-1 and glycoprotein 130 constitute a signal-transducing receptor
for IL-27. J Immunol 2004; 172: 2225.
13 Yamasaki K, Taga T, Hirata Y, et al.
Cloning and expression of the human interleukin-6 (BSF-2/IFN beta
2) receptor. Science 1988; 241: 825.
14 Hilton DJ, Hilton AA, Raicevic A, et al.
Cloning of a murine IL-11 receptor alpha-chain; requirement for
gp130 for high affinity binding and signal transduction. EMBO J
1994; 13: 4765.
15 Gearing DP, Thut CJ, VandeBos T, et al.
Leukemia inhibitory factor receptor is structurally related to the
IL-6 signal transducer, gp130. EMBO J 1991; 10: 2839.
16 Gearing DP, Comeau MR, Friend DJ, et al.
The IL-6 signal transducer, gp130: an oncostatin M receptor and
affinity converter for the LIF receptor. Science 1992; 255:
1434.
17 Davis S, Aldrich TH, Valenzuela DM,
et al. The receptor for ciliary neurotrophic factor. Science
1991; 253: 59.
18 Pennica D, King KL, Shaw KJ, et al.
Expression cloning of cardiotrophin 1, a cytokine that induces
cardiac myocyte hypertrophy. Proc Natl Acad Sci USA 1995; 92:
1142.
19 Elson GC, Lelievre E, Guillet C, et al.
CLF associates with CLC to form a functional heteromeric ligand for
the CNTF receptor complex. Nat Neurosci 2000; 3: 867.
20 Derouet D, Rousseau F, Alfonsi F, et al.
Neuropoietin, a new IL-6-related cytokine signaling through the
ciliary neurotrophic factor receptor. Proc Natl Acad Sci USA 2004;
101: 4827.
21 Mosley B, De Imus C, Friend D, et al.
Dual oncostatin M (OSM) receptors. Cloning and characterization of
an alternative signaling subunit conferring OSM-specific receptor
activation. J Biol Chem 1996; 271: 32635.
22 Pflanz S, Timans JC, Cheung J, et al.
IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein,
induces proliferation of naive CD4(+) T cells. Immunity 2002; 16:
779.
23 Dreuw A, Radtke S, Pflanz S, Lippok BE,
Heinrich PC, Hermanns HM. Characterization of the
signaling capacities of the novel gp130-like cytokine receptor GPL.
J Biol Chem 2004; (in press).
24 Dillon SR, Sprecher C, Hammond A, et al.
Interleukin 31, a cytokine produced by activated T cells, induces
dermatitis in mice. Nat Immunol 2004; 5: 752.
25 Lelievre E, Plun-Favreau H, Chevalier S,
et al. Signaling pathways recruited by the cardiotrophin-like
cytokine/cytokine-like factor-1 composite cytokine: specific
requirement of the membrane-bound form of ciliary neurotrophic
factor receptor alpha component. J Biol Chem 2001; 276: 22476.
26 Liu J, Modrell B, Aruffo A, et al.
Interleukin-6 signal transducer gp130 mediates oncostatin M
signaling. J Biol Chem 1992; 267: 16763.
27 Auguste P, Guillet C, Fourcin M, et al.
Signaling of type II oncostatin M receptor. J Biol Chem 1997; 272:
15760.
28 Kuropatwinski KK, De Imus C, Gearing D,
Baumann H, Mosley B. Influence of subunit combinations on
signaling by receptors for oncostatin M, leukemia inhibitory
factor, and interleukin-6. J Biol Chem 1997; 272: 15135.
29 Nicholson SE, De Souza D, Fabri LJ,
et al. Suppressor of cytokine signaling-3 preferentially binds
to the SHP-2-binding site on the shared cytokine receptor subunit
gp130. Proc Natl Acad Sci USA 2000; 97: 6493.
30 Lehmann U, Schmitz J, Weissenbach M,
et al. SHP2 and SOCS3 contribute to Tyr-759-dependent
attenuation of interleukin-6 signaling through gp130. J Biol Chem
2003; 278: 661.
31 Stahl N, Farruggella TJ, Boulton TG,
Zhong Z, Darnell Jr. JE, Yancopoulos GD. Choice
of STATs and other substrates specified by modular tyrosine-based
motifs in cytokine receptors. Science 1995; 267: 1349.
32 Kim H, Hawley TS, Hawley RG, Baumann H.
Protein tyrosine phosphatase 2 (SHP-2) moderates signaling by gp130
but is not required for the induction of acute-phase plasma protein
genes in hepatic cells. Mol Cell Biol 1998; 18: 1525.
33 Kim H, Baumann H. Dual signaling role of the
protein tyrosine phosphatase SHP-2 in regulating expression of
acute-phase plasma proteins by interleukin-6 cytokine receptors in
hepatic cells. Mol Cell Biol 1999; 19: 5326.
34 Wang Y, Robledo O, Kinzie E, et al.
Receptor subunit-specific action of oncostatin M in hepatic cells
and its modulation by leukemia inhibitory factor. J Biol Chem 2000;
275: 25273.
35 Fukada T, Hibi M, Yamanaka Y, et al. Two
signals are necessary for cell proliferation induced by a cytokine
receptor gp130: involvement of STAT3 in anti-apoptosis. Immunity
1996; 5: 449.
36 Thoma B, Bird TA, Friend DJ, Gearing DP,
Dower SK. Oncostatin M and leukemia inhibitory factor trigger
overlapping and different signals through partially shared receptor
complexes. J Biol Chem 1994; 269: 6215.
37 Blanchard F, Duplomb L, Wang Y, et al.
Stimulation of leukemia inhibitory factor receptor degradation by
extracellular signal-regulated kinase. J Biol Chem 2000; 275:
28793.
38 Hermanns HM, Radtke S, Schaper F,
Heinrich PC, Behrmann I. Non-redundant signal
transduction of interleukin-6-type cytokines. The adapter protein
Shc is specifically recruited to rhe oncostatin M receptor. J Biol
Chem 2000; 275: 40742.
39 Grotzinger J. Molecular mechanisms of cytokine receptor
activation. Biochim Biophys Acta 2002; 1592: 215.
40 Ihle JN. The Stat family in cytokine signaling. Curr
Opin Cell Biol 2001; 13: 211.
41 Miyakawa Y, Rojnuckarin P, Habib T,
Kaushansky K. Thrombopoietin induces phosphoinositol 3-kinase
activation through SHP2, Gab, and insulin receptor substrate
proteins in BAF3 cells and primary murine megakaryocytes. J Biol
Chem 2001; 276: 2494.
42 Zarling JM, Shoyab M, Marquardt H,
Hanson MB, Lioubin MN, Todaro GJ. Oncostatin M: a
growth regulator produced by differentiated histiocytic lymphoma
cells. Proc Natl Acad Sci USA 1986; 83: 9739.
43 Rose TM, Bruce AG. Oncostatin M is a member of a
cytokine family that includes leukemia-inhibitory factor,
granulocyte colony-stimulating factor, and interleukin 6. Proc Natl
Acad Sci USA 1991; 88: 8641.
44 White DW, Tartaglia LA. Evidence for
ligand-independent homo-oligomerization of leptin receptor (OB-R)
isoforms: a proposed mechanism permitting productive long-form
signaling in the presence of excess short-form expression. J Cell
Biochem 1999; 73: 278.
45 Ross RJ, Esposito N, Shen XY, et al. A
short isoform of the human growth hormone receptor functions as a
dominant negative inhibitor of the full-length receptor and
generates large amounts of binding protein. Mol Endocrinol 1997;
11: 265.
46 Perrot-Applanat M, Gualillo O, Pezet A,
Vincent V, Edery M, Kelly PA. Dominant negative and
cooperative effects of mutant forms of prolactin receptor. Mol
Endocrinol 1997; 11: 1020.
47 Schuler LA, Lu JC, Brockman JL. Prolactin
receptor heterogeneity: processing and signalling of the long and
short isoforms during development. Biochem Soc Trans 2001; 29:
52.
48 Flynn A, Whittington H, Goffin V, Uney J,
Norman M. A mutant receptor with enhanced dominant-negative
activity for the blockade of human prolactin signalling. J Mol
Endocrinol 2004; 32: 385.
49 Radtke S, Hermanns HM, Haan C, et al.
Novel role of Janus kinase 1 in the regulation of oncostatin M
receptor surface expression. J Biol Chem 2002; 277: 11297.
50 Coers J, Ranft C, Skoda RC. A truncated
isoform of c-mpl with an essential C-terminal peptide targets the
full-length receptor for degradation. J Biol Chem 2004; (in
press).
|
Version imprimable
Version PDF
