Interleukin-12 induces genes expression in interleukin-2 stimulated human T lymphocytes

ARTICLE

INTRODUCTION

Interleukin-12 (IL-12) is a heterodimeric cytokine (p70) composed of p40 and p35 subunits. IL-12 is produced by antigen-presenting cells (APC) such as dendritic cells, Langerhans cells and B cells [1]. The production of IL-12 is induced by bacteria, fungi, viruses, and their products, in a T cell-independent pathway. IL-12 is also induced in a T cell-dependent pathway via the interaction of CD40 on APC, and CD40 ligand (CD40L) on activated T cells [2, 3]. The biological response to IL-12 is mediated through specific binding to a high affinity receptor complex composed of at least two subunits (designated IL-12R beta1 and IL-12R beta2) that are expressed on NK cells and activated T cells [4-6]. IL-12 plays an important role in the biological activities of human T and natural killer (NK) cells, including induction of differentiation and proliferation of Th1 cells, an increase in IFN-gamma production, an enhancement of the lytic activity of NK cells and antigen specific cytolytic T lymphocyte responses. In addition, IL-12 also induces expression of L-selectin and P-selectin ligand [7-10]. Recently it has been found that IL-12 up-regulates the expression of IFN-regulating factor-1 (IRF-1), CD40L (CD154) and the IL-18 receptor on human peripheral blood T cells [11-13]. Stimulation of activated T cells with IL-12 leads to tyrosine phosphorylation and activation of Jak-2 and Tyk-2 kinases, as well as STAT3 and STAT4 transcription factors [14, 15].

IL-2 is produced by activated CD4 T cells and acts on T, B cells and monocytes [16]. IL-2 on induced phosphorylation of Jak1, Jak3, and STAT1 and STAT5, as well as STAT3 only in preactivated T cells. IL-2 also induced STAT4 activation in primary NK cells and NK cell lines, but not in T cells [17, 18].

IL-12 has synergistic effects with IL-2 as regards production of cytokines, enhancement of cytotoxicity, and proliferation of activated cells. The functional synergy between IL-12 and IL-2 in T cells seems to correlate with the activation of the stress kinases, stress-activated protein (MAP) kinase and stress-activated protein kinase (SAPK)/Jun N-terminal kinase which are associated with a prominent increase in STAT1 and STAT3 serine phosphorylation [15, 19].

To identify the IL-12-inducible genes involved in these different activities, we compared the gene expression in human T lymphocytes activated by IL-2 and IL-12. mRNA from T lymphocytes activated by either IL-2 and IL-12 or IL-2 alone were transcribed into cDNAs. A differential mRNA display was conducted. Five differential displays of cDNA fragments were obtained. Sequence analysis using a computer search against GenBank suggests that they had high homology with recorded genes. Two full genes were cloned, which code activation-induced C-type lectin and glucose transporter-like protein. These genes were only expressed in the T cells stimulated by IL-2 and IL-12, but not in the T cells stimulated by IL-2 alone. These results suggest that C-type lectin and glucose transporter-like protein may play an important role in the T lymphocyte activation induced by IL-12.

MATERIALS AND METHODS

Lymphocyte preparation

Human PBMC were prepared from venous blood obtained from healthy individuals, by density gradient centrifugation. T cells were isolated by using standard E-rosetting procedure.

Lymphocyte activation

Purified T lymphocytes were cultured in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum, 2 mM glutamine, 10 mM HEPES, 2-ME, penicillin and streptomycin, and were stimulated with either IL-2 (1,000 U/ml) or IL-2 (1,000 U/ml) plus IL-12 (5 ng/ml) which was kindly provided by Dr. Maurice Gately (Hoffmann-La Roche Inc., NJ, USA).

RT-PCR differential display

After cells were incubated with cytokines for 4 h, total RNA was extracted using TRIZOL Reagent (Total RNA Isolation Reagent, Life Technologies), following the manufacturer's instructions. cDNA preparation and PCR was performed as described by Liang and Paradee Favia [20], and modified as follows: [1] for cDNA preparation, total RNA (1-5 ug) was reverse transcribed using 1.25 µl anchor primer (AN1,AN2), 10 µM deoxynucleotide triphosphate and 7 units AMV (avian myeloblastosis virus) reverse transcriptase (Takara Biotechnology Co., Ltd. Japan). The mixtures were incubated for 10 min at room temperature and then for 60 min at 37° C and finally for 2 min on ice. (2) for PCR, the amplifications were set up by mixing 1 µl of the reverse transcription reaction, 4 pmol of anchor primer, 4 pmol of arbitrary primer (AR8; AR12; AR15; AR20), 40 pmol of dNTP and 1 Unit of Taq polymerase (Takara Biotechnology Co., Ltd. Japan). PCR was performed at 95° C for 3 min; 95° C for 30 sec, 40° C for 2 min, and 68° C for 1 min for 3 cycles; 95° C for 30 sec, 56° C for 1 min, and 72° C for 1 min for 35 cycles. Finally, the samples were heated to 72° C for 5 min and then cooled to 4° C. The PCR products were separated on 2% agarose gel. Electrophoresis was performed for 2 hours at 100 V in 1 x TBE buffer. Interesting bands were cut off from the gel and purified using Advantage TM PCR-Pure Kit (CLONTECH).

Cloning and sequence analysis

The purified cDNA samples were reamplified using PCR with the same primers. The cycling parameters were at 94° C for 3 min; 94° C for 45 sec, 56° C for 1 min and 72° C for 1 min for 35 cycles; 72° C for 7 min. The PCR products were ligated into a pUC19 vector (GIBCO-BRL) and transformed into Escherichia coli DH5a (GIBCO-BRL) competent cells using standard molecular biological techniques [21]. The cloned DD-PCR fragments were sequenced using an automated DNA sequencer (Applied Biosystems Inc.). All nucleotide sequence data were investigated for homologous sequences using the basic local alignment search tool (BLAST).

Cloning and analysis of GLUT3 and AICL

Total RNA was prepared as described above. cDNA synthesis was performed directly on the total RNA with AMV reverse transcriptase (Takara Biotechnology Co., Ltd. Japan) for 1 hour at 42° C following 10 min at room temperature using a specific downstream primer. PCR amplification was performed using specific primers for GLUT3, AICL. The oligonucleotides used were as follows: GLUT3 upstream primer, 5' ACAGCGATGGGGACACAGAAG 3', and GLUT3 downstream primer, 5' GAGGTGGAAGGAGGCACGACT 3'; AICL upstream primer 5' AAAGAAGCACGGTATGATGAC 3', and AICL downstream primer 5' ATTTTCCCCATTATCTTAGACAT 3'.

The PCR products were analyzed on 0.8% agarose gels, size-selected PCR products were isolated from agarose gels using Advantage TMPCR-Pure Kit (CLONTECH) and ligated into pUC119 Vector (GIBCO-BRL). The cloned PCR fragments were sequenced, the database comparisons were performed with BLAST software.

RESULTS

Differential gene expression in human T cells activated with IL-2 and IL-12.

To identify genes specifically involved in T cell activation, mRNA isolated from T cells activated by either IL-2 alone or by a combination of IL-2 and IL-12 was analyzed by the differential display technique for the presence of genes. Thirty PCRs with different primer sets were performed to obtain a spectrum of 2,000 cDNA fragments. Three cDNA fragments were considered to be specific for T cells activated with IL-2 and IL-12 (Figure 1d, f and h), but not with IL-2 alone. Two cDNA fragments were considered to be associated with the down-modulation of IL-12 in human T cells (Figure 1a and g).

Cloning and analysis of cDNAs

Five differentially expressed cDNA clones were sequenced, and a homology search in the EMBL/GenBank databases was performed using the BLAST Server. 2NR215 clone and 2NR120 clone are present in T cells stimulated by IL-2, only but are absent in T cells stimulated by IL-2 plus IL-12. 5NR108, 5NR112 and 5NR120 are only present in T cells stimulated by IL-2 plus IL-12. The clones were homologous to known genes.

Clone 2NR215 is 169 bp long, 144 of them match to nucleotides 30208-31327 of the human chromosome 16 BAC clone CIT 987 SK-A-270G1 (gb accession No. AF001549); clone 5NR108 is 255 bp long and is located between nucleotides 3633-3891 of human glucose transporter-like protein-III (GLUT3) (gb accession No. M20681) according to the numbering reported by Kayano et al. [21]; clone 5NR112 is 172 bp long and matches to nucleotides 512-676 of H. sapiens mRNA for activation-induced C-type lectin (AICL) (emb accession No. X96719) [22]; clone 2NR120 is 149 bp long and shows > 99% homology to H. sapiens mRNA for KIAA0854 protein (dbj accession No. ABO20661) and A at 3951 is replaced by G: clone 5NR120 shows > 95% homology to human ADP/ATP translocase mRNA, 3'end (gb accession No. J03592), 149 bp long and is located between nucleotides 968-1,116 of 1,116 bp, according to the numbering reported by Houldsworth et al.[23] and G at 1061 is replaced by A.

Analysis of GLUT3 and AICL

To confirm that these bands represent indeed GLUT3 and AICL, RT-PCR was undertaken, using primers that were designed according to the full-length sequences published in Genbank [22, 23]. An approximately 1,510 bp GlUT3 band and 490 bp AICL band were obtained as predicted, by the location of primers within the GLUT3 and AICL sequence (Figure 2). Sequencing of the GLUT' disclosed 100% identity with the corresponding human glucose transporter-like protein-III (data not shown). Sequencing of AICL' disclosed 98% identity with the corresponding H. sapiens mRNA for AICL (activation-induced C-type lectin) or 98% identify with H. sapiens mRNA for type II membrane protein similar to CD69 (dbj accession No. ABO15628).

DISCUSSION

The intracellular events regulating gene expression upon IL-12 stimulation are only partially understood. In order to identify IL-12-inducible genes involved in T cells, we compared the gene expression in human T lymphocytes activated by IL-2 and IL-12. mRNAs from activated T lymphocytes were transcribed into cDNAs. By performing a differential mRNA display, we were able to identify multiple cDNA fragments coding for genes that are specifically expressed in T cells after activation by a combination of IL-2 and IL-12 or IL-2 alone. Five differential display cDNA fragments were obtained. Sequence analysis suggests that they had high homology with recorded genes following a computer search against GenBank. Of these, two full genes were cloned, which coded for activation-induced C-type lectin and glucose transporter-like protein. They were only expressed in the T cells stimulated by IL-2 and IL-12, but not in the T cells stimulated by IL-2 alone. These results suggest that they may play an important role in the T lymphocyte activation induced by IL-12.

In this report, we have shown that IL-12 induced the expression of activation-induced C-type lectin (AICL) on T cells. The AICL gene was first obtained from the cDNA library from PMA-activated peripheral blood mononuclear cells. AICL is a new activation-induced antigen encoded by the human NK gene complex [24], A large family of NK cell receptors belong to the C-type lectin superfamily and are localized to the NK gene complex on chromosome 6 in mouse and chromosome 12 in human. Genes in the NK gene complex encode type II transmembrane proteins with a C-type lectin domain which trigger or inhibit target cell lysis by NK cells or function as cellular activators of various hematopoietic cells (CD69). The gene for activation induced C-type lectin maps to the human NK gene complex proximal to the CD69 gene [25]. Recently, a novel cDNA clone encoding putative membrane proteins of a type similar to CD69 was also cloned from a human full-length cDNA bank [26]. It has high similarity to AICL (Figure 3). Another novel cDNA clone is lectin-like transcript (LLT1), which is expressed on NK, T, and B cells, and is localized to the NK gene complex within 100 kilobases of CD69. The predicted protein of LLT1 shows 59 and 56% similarity to AICL and CD69, respectively. AICL is a 149-amino acid polypeptide. The highest sequence similarity is found in the C-type lectin domains of CD69 [27]. The CD69 C-type lectin is reportedly to be the earliest activation antigen on lymphocytes and can be detected within hours of mitogenic stimulation [28]. The C-type lectin superfamily plays an important role in the immune system. Many animal lectins (sugar-binding proteins) mediate both pathogen recognition and cell-cell interactions using structurally related Ca²⁺-dependent carbohydrate-recognition domains (C-type CRDs) [29]. In our study, we found that AICL was expressed on T cells stimulated by IL-2 plus IL-12, but not expressed on the T cells stimulated by only IL-2; this suggests that AICL is an activation inducer molecule, an early activation antigen, and that IL-12 can induce the production of AICL.

We have found that glucose transporter-like protein-III (GLUT3) is expressed on the T cells stimulated by IL-12. Glucose transporters are a family of membrane proteins, which mediate glucose uptake across the cell membrane. These facilitative glucose transporter proteins have unique tissue distribution and biochemical properties underlying specific physiological functions [30]. GLUT3 is expressed at various levels in many tissues, including cerebrum, placenta, retina, muscle and myocardium [31-34]. To date, very few studies concerning GLUT3 in lymphocytes have been published. GLUT3 transporter can be detected in the H9 cells (T-cell lines), but not in U937 cells (a promonocytic cell line). Acute HIV infection of H9 cells led to increased cellular transport activity and GLUT3 transporter content, but glucose transport and the GLUT3 transporters are not increased in cells chronically infected with HIV-1 [35]. Resting human peripheral blood lymphocytes (PBL) express glucose transporter isoforms GLUT2 and GLUT3, but not GLUT1. After PHA stimulation, the expression of GLUT1 instead of GLUT3 is induced by IL-2 binding to its high affinity receptors [36]. In our study, we found that GLUT3 is not expressed (or only at a low level) on T cells that have been stimulated by IL-2 only. It is similar to the observation that expression was downregulated on PBL after PHA stimulation [36]. We also found that T cells stimulated with IL-2 plus IL12 have increased expression of GLUT3. Based on these observations, we might conclude that GLUT3 could be induced on human T cells by IL-12 and inhibited by IL-2, suggesting that IL-12-induced GLUT3 expression may play an important role in the IL-12-mediated biological function of T cell activation.

Two gene fragments downregulated by IL-12 on T cells were obtained in our study. Clone 2NR215 had high similarity to human chromosome 16 BAC CIT987sk-A-270G1 but its product is unknown (protein-id = AAC27822.1), because it does appear in the T cells stimulated by IL-2 and IL-12. We suggest that IL-12 may inhibit its expression. Clone 2NR120 is greatly similar to H. sapiens mRNA for KIAA0854 protein (Nagase et al.). The sequences of 100 cDNA clones have been recently determined from a set of size-fractionated human brain cDNA libraries and the coding sequences of the corresponding genes, named KIAA0819 to KIAA0918 have been predicted. It is still not clear about the KIAA0854 protein (protein-id = BAA74877.1), but our study shows it can be induced in T cells stimulated by IL-2 and inhibited by IL-12. Clone 5NR120 shows great similarity to human ADP/ATP translocase. Expression of the ADP/ATP translocase genes in human cells is sensitive to the physiological conditions as seen by changes in the rate of synthesis or stability of their mRNA [37]. In our study, we found that IL-2- and IL-12-activated T cells showed a higher rate of mRNA synthesis than IL-2 activated T cells.

CONCLUSION

In summary, the data reported in this work present preliminary evidence for IL-12 modulating sequences of T cell activation. AICL may be an immediate-early activation gene in T cells that can be induced by IL-12. Although IL-12 also induces other gene fragments, their corresponding proteins remain unknown. Further study is needed to identify the distribution and regulation of the expression of these genes in different tissues as well as for different activation time periods.

Accepted for publication: 21/06/00

Acknowledgements. This work was completed at National Key Laboratory of Veterinary Biotechnology, Harbin, China. We would like to thank Drs. G.Z. Tong and X.G. Kong for their help and valuable advice during this work. We also thank X. Guo, L.H. Yan, and P.X. Liu for their expert technical assistance. This work was supported by a grant from the Natural Science Foundation of Helongjiang Province.

REFERENCES

1. Trinchieri G. 1998. Immunobiology of interleukin-12. (Review) Immunol. Res. 17: 269.

2. McDyer J F, Wu C Y, Seder R A. 1998. The regulation of IL-12: its role in infectious, autoimmune, and allergic diseases. J. Allergy Clin. Immunol. 102: 11.

3. Shu U, Kiniwa M, Wu C Y, Maliszewski C, Vezzio N, Hakimi J, Gately M, Delespesse G. 1995. Activated T cells induce interleukin-12 production by monocytes via CD40-CD40 ligand interaction. Eur. J. Immunol. 25: 1125.

4. Sinigaglia F, D'Ambrosio D, Panina-Bordignon P, Rogge L. 1999. Regulation of the IL-12/IL-12R axis: a critical step in T-helper cell differentiation and effector function. (Review) Immunol. Rev. 170: 65.

5. Rogge L, Sinigaglia F. 1997. Early events controlling T-helper cell differentiation: the role of the IL-12 receptor. (Review) Chem. Immunol. 68: 38.

6. Stern A S, Gubler U, Presky D H, Magram J. 1997. Structural and functional aspects of the IL-12 receptor complex. (Review) Chem. Immunol. 68: 23.

7. Lee S M, Suen Y, Qian J, Knoppel E, Cairo M S. 1998. The regulation and biological activity of interleukin 12. (Review) Leuk. Lymphoma 29: 427.

8. Wu C Y, Demeure C, Kiniwa M, Gately M, Delespesse G. 1993. IL-12 induces the production of IFN-gamma by neonatal human CD4 T cells. J. Immunol. 151: 1938.

9. Yan Wely C A, Beverley P C. Brett S J, Britten C J, Tite J P. 1999. Expression of L-selectin on Th1 cells is regulated by IL-12. J.Immunol. 162: 1214.

10. Lim Y C, Henault L, Wagers A J, Kansas G S, Luscinskas F W, Lichtman A H. 1999. Expression of functional selectin ligands on Th cells is differentially regulated by IL-12 and IL-4. J. Immunol. 162: 3193.

11. Galon J, Sudarshan C, Ito S, Finbloom D, O'Shea J J. 1999. IL-12 induces IFN regulating factor-1 (IRF-1) gene expression in human NK and T cells. J. Immunol. 162: 7256.

12. Peng X, Remacle J E, Kasran A, Huylebroeck D, Ceuppens J L. 1998. IL-12 up-regulates CD40 ligand (CD154) expression on human T cells. J. Immunol. 160: 1166.

13. Yoshimoto T, Takeda K, Tanaka T, Ohkusu K, Kashiwamura S, Okamura H, Akira S, Nakanishi K. 1998. IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-gamma production. J. Immunol. 161: 3400.

14. Heim M H. 1999. The Jak-STAT pathway: cytokine signalling from the receptor to the nucleus. (Review) J. Recept. Signal Transduct. Res. 19: 75.

15. Bacon C M, Petricoin E F 3rd, Ortaldo J R, Rees R C, Larner A C, Johnston J A, O'Shea J J. 1995. Interleukin-12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92: 7307.

16. Theze J, Alzari P M, Bertoglio J. 1996. Interleukin-2 and its receptors: recent advances and new immunological function. (Review) Immunol. Today 17: 481.

17. Kirken R A, Rui H, Malabarba M G, Howard O M, Kawamura M, O'Shea J J, Farrar W L. 1995. Activation of JAK3, but not JAK1, is critical for IL-2 induced proliferation and STAT5 recruitment by COOH-terminal region of IL-2 receptor beta-chain. Cytokine 7: 689.

18. Wang K S, Ritz J, Frank D A. 1999. IL-2 induces STAT4 activation in primary NK cells and NK cell lines, but not in T cells. J Immunol. 162: 299.

19. Gollob J A, Schnipper C P, Murphy E A, Ritz J, Frank D A. 1999. The functional synergy between IL-12 and IL-2 involves p38 mitogen-activated protein kinase and is associated with the augmentation of STAT serine phosphorylation. J. Immunol. 162: 4472.

20. Liang P, Averboukh L, Pardee A B. 1993. Distribution and cloning of eukaryotic mRNAs by means of differential display refinements and optimization. Nucleic Acids Res. 21: 3269.

21. Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular cloning: a laboratory Manual, Ed.2. : 1.72-1.84.

22. Kayano T, Fukumoto H, Eddy R L, Fan Y S, Byers M G, Shows T B, Bell G I. 1988. Evidence for a family of human glucose transporter-like poteins: sequence and gene localizarion of a protein expressed in fetal skeletal muscle and other tissues. J. Biol. Chem. 263: 15245.

23. Houldsworth Y, Chaganti R S. 1994. Comparative genomic hybridization: an overview. (Review). Am. J. Pathol. 145: 1253.

24. Hamann J, Montgomery K T, Lau S, Kucherlapati R, van Lier R A. 1997. AICL: a new activation-induced antigen encoded by the human NK gene complex. Immunogenetics 45: 295.

25. Marzio R, Mauel J, Betz-Corradin S. 1999. CD69 and regulation of the immune function. (Review) Immunopharmacol. Immunotoxicol. 21: 565

26. Yokoyama-Kobayashi M, Yamaguchi T, Sekine S, Kato S. 1999. Selection of cDNAs encoding putative type II membrane proteins on the cell surface from a human full-length cDNA bank. Gene 228: 161.

27. Boles K S, Barten R, Kumaresan P R, Trowsdale J, Mathew P A. 1999. Cloning of a new lectin-like receptor expressed on human NK cells. Immunogenetics 59: 1.

28. Craston R, Koh M, McDermott A, Ray N, Prentice H G, Lowdell M W. 1997. Temporal dynamics of CD69 expression on lymphoid cells. J. Immunol. Methods 209: 37.

29. Weis W I, Taylor M E, Drickamer K. 1998. The C-type lectin superfamily in the immune system. (Review) Immunol. Rev. 163: 19.

30. Ogihara T, Asano T. 1997. Glucose transporter gene. (Review) Nippon. Rinsho. 55 (suppl): 473.

31. Badr G A, Zhang J Z, Tang J, Kern T S, Ismsil-Beigi F. 1999. Glut1 and glut3 expression, but not capillary density, is increased by cobalt chloride in rat cerebrum and retina. Brain Res. Mol. Brain Res. 64: 24.

32. Kamei Y, Tsutsumi O, Yamakawa A, Oka Y, Taketani Y, Imaki J. 1999. Maternal epidermal growth factor deficiency causes fetal hypoglycemia and intrauterine growth retardation in mice: possible involvement of placental glucose transporter GLUT3 expression. Endocrinology 140: 4236.

33. Stuart C A, Wen G, Jiang J. 1999. GLUT3 protein and mRNA in autopsy muscle specimens. Metabolism 48: 876.

34. Grover-McKay M, Walsh S A, Thompson S A. 1999. Glucose transporter 3 (GLUT3) protein is present in human myocardium. Biochim. Biophys. Acta 1416: 145.

35. Caro C, Colby-Germinario S, Brenner B, Oliveira M, Wainberg M A, Germinario R J. 1998. Sugar transport and glut transporter expression in a variety of human immunodeficiency virus-1(HIV-1) chronically infected target cell lines. Int. J. Biochem. Cell Biol. 30: 1031.

36. Chakrabarti R, Jung C Y, Lee T P, Liu H, Mookerjee B K. 1994. Changes in glucose transport and transporter isoforms during the activation of human peripheral blood lymphocytes by phytohemagglutinin. J. Immunol. 152: 2660.

37. Lunardi J, Attardi G. 1991.Differential regulation of expression of the multiple ADP/ATP translocase genes in human cells. J. Biol. Chem. 266: 16534.