Prolactin activates interferon regulatory factor-1 expression in normal lympho-hemopoietic cells

ARTICLE

INTRODUCTION

PRL is synthesized and secreted primarily by the anterior pituitary. Its best known functions in mammals include stimulation of growth and differentiation of the mammary gland, the ovary and male accessory sex organs [1]. PRL is also expressed in extra-pituitary tissues [2, 3] and has been shown to affect immune responses [2, 3]. PRL-receptor (PRL-R), a member of the hemopoietin/cytokine receptor superfamily [4, 5], is expressed on most leukocytes [2-6]. In a model system, the PRL-dependent Nb2 rat T lymphoma cell line [6], dimerization of the PRL-R induces tyrosine phosphorylation and activation of the JAK2 tyrosine kinase [7, 8], followed by recruitment and phosphorylation of cytoplasmic Stat proteins, which translocate into the nucleus where they bind to specific promoter elements and regulate gene expression [9, 10]. The mechanism by which PRL signals in non-transformed leukocytes has not yet been elucidated.

In this paper we analyze PRL-R signaling in lympho-hemopoietic cells. We demonstrate that in spleen and bone marrow cells, PRL activates the JAK2/Stat pathway and stimulates IRF-1 gene expression.

MATERIALS AND METHODS

Animals

Rat spleen, bone marrow and thymus were harvested for Western blotting, immunoprecipitation, electrophoretic mobility shift assay (EMSA), and polymerase chain reaction (PCR ) analysis.

Cell isolation

Single cell suspensions were obtained by mincing spleen and thymus in HBSS, followed by flushing through N° 60 wire mesh. Bone marrow cells were flushed from long bones with HBSS. Red blood cells were lysed. Nb2 cells were cultured as described [6]. Cells (2 x 10⁷ cells/ml) were stimulated with PRL as indicated in figure legends.

Western blot analysis

Four million bone-marrow and spleen cells and 10⁶ Nb2 cells were lysed. Proteins were separated on 10% SDS-PAGE, and immunoblotted with a rabbit antiserum (AS) against the rat PRL-R (1:2,500) that recognizes a 23 amino acid sequence in the intracellular domain (10), followed by donkey anti-rabbit conjugated to horseradish peroxidase (1:10,000). For control experiments, the first antiserum was pre-incubated with the peptide used for immunization. Proteins were detected by enhanced chemoluminescence (ECC).

Metabolic labeling and immunoprecipitation of the PRL-R

Ten million Nb2 cells and twenty million bone marrow or spleen cells were labeled for 16 hours with 100 muCi/ml (³⁵S) methionine and cysteine (Tran³⁵S-Label, > 1,000 Ci/mmol, ICN) to achieve steady state labeling. Cells were lysed in 1 ml RIPA buffer containing 50 mM Tris pH 7.6, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 6 mM EDTA, 50 mug/ml leupeptin, 50 mug/ml pepstatin A, 10 mug/ml aprotinin, 500 mug/ml soybean trypsin inhibitor, and 1 mM AEBSF (4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride). Lysates were precleared with 5 mul normal rabbit serum (NRS) and 30 mul protein A-Sepharose (Sigma) and incubated overnight with rabbit anti-rat PRL-R AS [10]. Immunoprecipitated proteins were resolved by 10% SDS-PAGE and processed for autoradiography.

Detection of phosphorylated proteins

Thirty million cells were lysed in 100 mul ice-cold lysis buffer supplemented with phosphatases (10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate) and protease inhibitors. Lysates were incubated with 1 mul anti-phosphotyrosine monoclonal antibody (mAb) 4G10 (Upstate Biotechnology Inc.). Immune complexes were isolated with protein A-Sepharose resolved by 7.5% SDS-PAGE, transferred onto an Immobilon-P nylon membrane, immunoblotted with rabbit Ab against JAK2 (1:1,000) (UBI) and revealed as described above.

EMSA

Whole cell extracts (WCE) were prepared in buffer A (10 mM Hepes pH 7.9, 1.5 mM MgCl₂, 10 mM KCl, 2 mM dithiothreitol (DTT), 5 mM EDTA, with phosphatase and protease inhibitors). A 27-mer, double-stranded, labeled GAS probe (top strand AACAGCCTGATTTCCCCGAAATG and bottom strand TCATCATTTCGGGGAAATCAGGCTGTT) was used [11]. Five mug bone marrow WCE were incubated in 10 mul of reaction mixture containing 0.3 ng of labeled GAS probe (3-5 x 10⁴ cpm) for 20 min. Ab to Stat5b (1 mul) [11] were used in supershift assays. Samples were resolved by non-denaturing 5% acrylamide gel electrophoresis and analyzed by autoradiography.

PCR

Total RNA were prepared as described [12]. For cDNA synthesis for PRL-R, 10 mug of total RNA were reverse-transcribed in a 50 mul RT buffer containing 0.5 mM deoxy-NTP (dNTP), 1 mug oligo(dT)12-18 (Pharmacia) and 200 U MuLV RT (Bethesda Research Laboratories). For IRF-1 studies, the same conditions were used except that 1 mug total RNA in 20 mul containing 1 mM deoxy-NTP (dNTP) and 0.5 mug oligo(dT)12-18 was used. The PCR primers for PRL-R are: TM1 (sense) rat GAAGCAGAAGAGTGGGAGATCCATTTT and TM4 (antisense) mouse TCCTTTTATTTTTGGCCCCGGAACTGGTGG (309 bp); for IRF-1: (sense) TCTGAGTGGCATATGCAGATGGAC and (antisense) GGTCAGAGACCCAAACTATGGTGC (426 bp); for histone H3.3: (sense) GCAAGAGTGCGCCCTCTACTG and (antisense) GGCCTCACTTGCCTCCTGCAA (213 bp). The PCR conditions for PRL-R and H3.3 were 30 cycles of denaturation at 94° C for 30 s, annealing at 60° C for 60 s, extension at 72° C for 90 s and final extension at 72° C for 5 min; for IRF-1, 35 cycles of denaturation at 94° C for 45 s, annealing at 58° C for 45 s, extension at 72° C for 80 s and final extension at 69° C for 10 min. H3.3 products were resolved by 2.5% agarose gel electrophoresis, stained with ethidium bromide, and used as internal RT-PCR controls. For Southern analysis, PRL-R and IRF-1 PCR products were resolved on 1.2% and 2.5% agarose gel electrophoresis, respectively, blotted and hybridized with ³²P-labeled cDNA probes for PRL-R or IRF-1 (3 x 10⁹ cpm/mug) as described [13].

RESULTS

PRL-R is expressed in normal lympho-hemopoietic tissues

We examined PRL-R expression by RT-PCR employing primers that span the transmembrane domain (Figure 1A). A PCR product of the expected size (309 bp) was generated from Nb2 cells and bone marrow, spleen and thymus (Figure 1B). Southern hybridization using a rat PRL-R cDNA probe confirmed the specificity of the PCR products. Their relative expression levels were normalized against histone H3.3 (Figure 1C). Data demonstrate that the PRL-R is expressed in all leukocytes examined, with higher expression levels in spleen and thymus than in bone marrow. PRL-R expression was next examined in Nb2, rat bone marrow and spleen cells by Western analysis. With an anti-PRL-R Ab, a band of 64 kDa was found in Nb2 cells (Figure 2A, lane 1) and a band of 78 kDa in bone marrow and spleen cells (Figure 2A, lanes 2 and 3). Immunostaining of the 64 and 78 kDa proteins appears to be specific since they were not present when PRL-R Ab was pre-incubated with the PRL-R peptide used for immunization (Figures 2B and C). Biosynthesis of PRL-R was next examined in rat bone marrow and spleen cells. Cells were metabolically labeled and cell lysates were immunoprecipitated with PRL-R Ab (Figure 3). SDS-PAGE analysis of the immunoprecipitated products revealed a band of 64 kDa in the Nb2 cells (Figure 3, lane 1) and a band of 78 kDa in bone marrow and spleen cells (Figure 3, lanes 2 and 3). Immunoprecipitation of the 64 and 78 kDa proteins by the PRL-R Ab appears to be specific since they were not present in the NRS precipitates (results not shown). Thus, PRL-R synthesis (Figure 3) parallels RNA expression (Figure 1) in spleen cells. The discrepancy observed in bone marrow cells between RT-PCR products (Figure 1), metabolic labeling (Figure 3) on one hand and Western blotting (Figure 2) and immunocytochemistry (results not shown) on the other hand can be explained by the fact that these cells have lost part of their ability to synthesize new PRL-R but still bear functional receptors synthesized earlier.

PRL induces tyrosine phosphorylation of JAK2 in bone marrow and spleen cells

To test whether JAK tyrosine kinases were phosphorylated in response to PRL, lysates from unstimulated or from PRL-stimulated Nb2 (Figure 4A), bone marrow (Figure 4B) and spleen (Figure 4C) cells were immunoprecipitated with Ab to phosphotyrosine, followed by anti-JAK2 immunoblotting. A PRL-induced tyrosine phosphorylated protein of 130 kDa was recognized by Ab to JAK2. Both rat and recombinant hPRL induced JAK2 tyrosine phosphorylation in the bone marrow.

PRL stimulates Stat-5 binding to the IRF-1 GAS in bone marrow cells

Next, the ability of activated Stat-5 factor to bind to an IRF-1 GAS element was examined. WCE from bone marrow cells stimulated with PRL for 30 min were used in EMSA. Little binding was detected in extracts from non-stimulated (Figure 5, lane 2) cells. After 30 min of PRL stimulation, a PRL-inducible complex was found to interact with the IRF-1 GAS DNA (i, Figure 5, lane 3). This complex was specific since it could be competed for by an excess of cold GAS oligos (Figure 5, lane 4), and reproducibly observed in 5 independent experiments. COS cells transfected with the PRL-R and Stat-5b (Figure 5, lane 6) and stimulated with PRL for 30 min were used as controls. Complex i which contains Stat-5b (11), clearly interacted with the IRF-1 GAS element (Figure 5, lane 6) and was competed for by an excess of cold probe (data not shown).

To determine whether Stat-5b was present in the PRL-inducible complex in bone marrow cells, Ab against Stat-5b were employed in supershift assays (Figure 5, lane 5). The complex i was supershifted by anti-Stat-5b Ab (Figure 5, lane 5, SS5), indicating that Stat-5b is inducible by PRL in bone marrow cells. The specificity of complex i was confirmed by parallel supershifts of Stat-5b (Figure 5, lane 7) in transfected COS cells. The supershift in bone marrow cells is only partial, which suggests that other proteins may be present in the complex. Stat-5a is a likely candidate. Thus, we can conclude that PRL stimulates at least Stat-5b binding to the IRF GAS in bone marrow cells.

PRL induces IRF-1 expression in spleen and bone marrow cells

To determine whether a physiological concentration of PRL also stimulates IRF-1 gene expression in leukocytes, RT-PCR for IRF-1 was performed. A 426 bp IRF-1 PCR product was obtained (Figure 6A). In spleen and bone marrow cells IRF-1 PCR products were induced within 15 min (Figure 6A, lanes 4 and 8), and remained elevated 60 min after PRL stimulation (Figure 6A, lanes 6 and 10). This IRF-1 PCR product was identical to that obtained in Nb2 cells (Figure 6A, lanes 1 and 2). Thus at physiological concentrations of PRL (0.01 mug/ml) a significant and reproducible induction of IRF-1 expression was observed in spleen (2-fold) and bone marrow cells (10-fold) (Figure 6C). Interestingly, no increase in IRF-1 expression levels was observed in bone marrow (Figure 6B, lanes 11 and 12), at higher PRL concentrations. The absence of detectable PRL-induced expression of IRF-1 at these higher PRL concentrations could be due to higher occupancy of the PRL-R, which limits PRL-R dimerization and further signaling [4, 14]. These studies represent the first report of physiological PRL concentrations inducing the expression of IRF-1 in spleen and bone marrow cells.

DISCUSSION

To understand the function of PRL in the lympho-hemopoietic system, we have analyzed PRL-R signaling in normal rat leukocytes. We demonstrate here that the PRL-R is functional, and signals via the JAK/Stat pathway. One of the targets in the PRL signaling pathway is the IRF-1 gene [15]. We also show that a physiological concentration of PRL (0.01 mug/ml) is sufficient to activate the IRF-1 gene in these cells.

PRL-R is expressed in human and murine leukocytes [2, 16-18]. We show here that the rat PRL-R is expressed in leukocytes, with higher expression in spleen and thymus than in the bone marrow (Figure 1). Since the PCR primers were designed to span the transmembrane domain of the PRL-R, no distinction between the long and short forms of the PRL-R could be made. We further analyzed PRL-R expression by immunoblotting using the long form-specific PRL-R Ab (Figure 2), and identified a 78-kDa long form of PRL-R in bone marrow and spleen cells. This is similar to the size of the PRL-R described in other tissue [19]. In addition, the Ab also recognized the expected 64 kDa PRL-R in Nb2 cells, the smaller size of which is due to a deletion in the PRL-R gene [20]. Both the long and the Nb2 forms of the PRL-R are active in signaling for proliferation [21], differentiation [22] and protection against apoptosis [23]. The short PRL-R is expressed together with the long form in most tissues and may modulate long PRL-R function by heterodimer formation [4, 14, 24].

PRL induces JAK2 tyrosine phosphorylation in bone marrow, spleen and Nb2 cells (Figure 4). Further, PRL stimulates Stat factor binding to the IRF-1 GAS element in bone marrow cells (Figure 5). Stat-5b is found in the PRL-inducible complexes at the IRF-1 GAS. This binding activity is correlated with the activation of the IRF-1 gene in response to PRL stimulation in spleen and bone marrow cells (Figure 6). PRL induces IRF-1 gene expression as early as 15 min after stimulation, and IRF-1 expression is maintained after 30 and 60 min stimulation. This rapid induction is also observed in Con-A stimulated mouse splenocytes [25] and in PRL-stimulated Nb2 cells [6]. These combined studies demonstrate that PRL activates the JAK/Stat pathway in normal leukocytes, and this activation leads to the expression of the IRF-1 gene. IRF-1 knockout animals exhibit impairment in the development and/or function of CD8⁺ T [26], CD4⁺ Th1 helper cell [27, 28], macrophage [29] and NK cells [30]. Thus, PRL activation of a critical immune response regulator, IRF-1, is compatible with a role for PRL in modulating multiple functions in the immune system.

PRL is synthesized and secreted by cells in the mouse and human immune system [2]. Our studies also show that PRL is expressed in the rat bone marrow, spleen and thymus, which suggests that PRL can act as an autocrine or paracrine growth factor for leukocytes [31]. Which signals regulate the expression of lymphocyte PRL is currently unknown.

Although most effects of PRL seem to be mediated by the JAK/Stat signaling pathway, PRL is known to activate other signaling pathways, including the activation of various kinases [15, 32] and Ca⁺⁺ flux [33].

From mice with targeted disruption of the PRL (PRL-R^­/­) [34] and PRL receptor (PRL-R^­/­) [35] genes, emerges the picture that PRL is at best a non-obligatory immunoregulatory factor. However, it is conceivable that in these knock-out mice, a role for PRL was not detected because of the range of assays was too limited and /or not sensitive enough. It is also difficult to exclude a compensatory action of other cytokines, hormones or growth factors enabling normal development of the immune system. Indeed, many cytokines, hormones and growth factors share signaling molecules and this may account in part, for their functional redundancy. For example, PRL synergizes with IL-2 to induce the proliferation and maturation of NK cells [36]. This redundancy may explain why neither PRL [34] nor PRL-R [35] knock-out animals exhibit any significant defect in the ontogeny of the immune system. Conditional knock-out or double knock-out of PRL (or PRL-R) and another cytokine (or its receptor) might reveal a role for PRL in the lymphohemopoietic system.

Our current hypothesis states that PRL could have important homeostatic effects. The most convincing piece of evidence comes from manipulation of PRL levels in rodent models [37]. In addition, in vitro, in defined cell culture, PRL could modulate the effects of other cytokines (our unpublished results).

PRL could also act as an anti-stress mediator. In Nb2 cells, PRL could inhibit dexamethasone-induced apoptosis and thus antagonize the immunosuppressive action of glucocorticoids [38].

In vivo too, several lines of evidence suggest that the manipulation of PRL levels may be of benefit to the patients for example during reconstitution following bone-marrow transplantation, modulation of graft survival, and in the treatment of patients with auto-immune disease. The function of the immune system of knock-out animals in stress situation has not yet been addressed.

We finally would like to stress that few data are as yet available regarding the regulation of the expression of both PRL and PRL-R in leukocytes, making their function very difficult to evaluate. The information gained from in vivo as well as in vitro data may be crucial in the understanding of the role of the PRL-PRL-R complex in the immune system and may be of great value for designing new strategies for potential clinical use.

CONCLUSION

In summary, we demonstrate here that a physiological concentration of PRL activates normal leukocytes. PRL binds to PRL-R in bone marrow and spleen, activates the JAK2/Stat signaling pathway and stimulates the expression of IRF-1, a central mediator of various immune responses. Which cell types within these tissues respond(s) to PRL is currently under analysis.

Acknowledgements. Thanks to D. Eizirik, R. Hooghe and R. Kooijman for comments, to R. Stien and C. Yamalioglu for help with figures and to OZR-VUB, Pharmacia-Upjohn, the Flemish government (GOAs) for support.

REFERENCES

1. Hooghe-Peters E L, Hooghe R. 1995. Growth hormone, Prolactin and IGF-I as Lymphohemopoietic Cytokines. R.G. Landes Company, Austin.

2. Kooijman R, Hooghe-Peters E L, Hooghe R. 1996. Prolactin, growth hormone and insulin-like growth factor-1 in the immune system. (Review) Adv. Immunol. 63: 377.

3. Ben-Jonathan N., Mershon J L, Allen, D L, Steinmetz R W. 1996. Extrapituitary prolactin: distribution, regulation, functions, and clinical aspects. (Review) Endocr. Rev. 17: 639.

4. Kelly P A, Edery M, Finidori J, Postel-Vinay M C, Gougon L, Ali S, Dinerstein H, Sotiropoulos A, Lochnan H, Ferrag F, Lebrun, J J, Ormandy C, Buteau H, Esposito N, Vincent V, Moldru A. 1994. Receptor domains involved in signal transduction of prolactin and growth hormone. (Review) Proc. Soc. Exp. Biol. Med. 206: 280.

5. Horseman N D, Yu-Lee L Y. 1994. Transcriptional regulation by the helix-bundle peptide hormones: growth hormone, prolactin, and hematopoietic cytokines. (Review) Endocr. Rev. 15: 627.

6. Stevens A M, Wang Y F, Sieger K A, Lu H F, Yu-Lee L Y. 1995. Biphasic transcriptional regulation of the interferon regulatory factor-1 gene by prolactin: involvement of gamma-interferon-activated sequence and stat-related proteins. Mol. Endocrinol. 9: 513.

7. Campbell G S, Argetsinger L S, Ihle J N, Kelly P A, Rillema J A, Carter-Su C. 1994. Activation of JAK2 tyrosine kinase by prolactin receptors in Nb2 cells and mouse mammary gland explants. Proc. Natl. Acad. Sci. USA 91: 5232.

8. Rui H, Kirken R A, Farrar W L. 1994. Activation of receptor-associated tyrosine kinase JAK2 by prolactin. J. Biol. Chem. 269: 5364.

9. Wang Y F, Yu-Lee L Y. 1996. Multiple Stat complexes interact at the interferon regulatory factor-1 interferon-gamma activation sequence in prolactin-stimulated Nb2 T cells. Mol. Cell. Endocrinol. 121: 19.

10. Wang Y F, O'Neal K D, Yu-Lee L Y. 1997. Multiple prolactin (PRL) receptor cytoplasmic residues and Stat1 mediate PRL signaling to the interferon regulatory factor-1 promoter. Mol. Endocrinol. 11: 1353.

11. Luo G, Yu-Lee L Y. 1997. Transcriptional inhibition by Stat5: differential activities at growth-related versus differentiation-specific promoters. J. Biol. Chem. 272: 26841.

12. Chomczynski P, Sacchi N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analyt. Biochem 162: 156.

13. Delhase M, Rajas F, Verdood P, Remy C, Chevallier P, Velkeniers B, Trouillas J, Hooghe-Peters E L. 1995. Prolactin and growth hormone mRNA and protein characterization in SMtTW rat pituitary tumours. J. Mol. Endocrinol. 15: 233.

14. Fuh G, Colosi P, Wood W I, Wells J A. 1993. Mechanism-based design of prolactin receptor antagonist. J. Biol. Chem. 268: 5376.

15. Yu-Lee L Y. 1997. Molecular actions of prolactin in the immune system. (Review) Proc. Soc. Exp. Biol. Med. 215: 35.

16. Dardenne M, Kelly, P A, Bach J F, Savino W. 1991. Identification and functional activity of prolactin receptors in thymic epithelial cells. Proc. Natl. Acad. Sci. USA 88: 9700.

17. Pellegrini I, Lebrun J J, Ali S, Kelly P A. 1992. Expression of prolactin and its receptor in human lymphoid cells. Mol. Endocrinol. 6: 1023.

18. Dardenne M, de Moraes M do C, Kelly P A, Gagnerault M C. 1994. Prolactin receptor expression in human hematopoietic tissues analyzed by flow cytofluorometry. Endocrinology 134: 2108.

19. Okamura H, Zachwieja J, Raguet S, Kelly P A. 1989. Characterization and applications of monoclonal antibodies to the prolactin receptor. Endocrinology 124: 2499.

20. Ali S, Pellegrini I, Kelly P A. 1991. A prolactin-dependent immune cell line (Nb2) expresses a mutant form of prolactin receptor. J. Biol. Chem. 266: 20110.

21. O'Neal K D, Yu-Lee L Y. 1994. Differential signal transduction of the short, Nb2, and long prolactin receptors. Activation of interferon regulatory factor-1 and cell proliferation. J. Biol. Chem. 269: 26076.

22. Lesueur L, Edery M, Ali S, Paly J, Kelly P A, Djiane J. 1991. Comparison of long and short forms of the prolactin receptor on prolactin-induced milk protein gene transcription. Proc. Natl. Acad. Sci. USA 88: 824.

23. Fletcher-Chiappini S E, Compton M M, LaVoie H A, Day E B, Witorsch R J. 1993. Glucocorticoid-prolactin interactions in Nb2 lymphoma cells: antiproliferative versus anticytolytic effects. Proc. Soc. Exp. Biol. Med. 202: 345.

24. Chang, W P, Clevenger C V. 1996. Modulation of growth factor receptor function by isoform heterodimerization. Proc. Natl. Acad. Sci. USA. 93: 5947.

25. Schwarz L A, Stevens A M, Hrachovy J A, Yu-Lee L Y. 1992. Interferon regulatory factor-1 is inducible by prolactin, interleukin-2 and concanavalin A in T cells. Mol. Cell. Endocrinol. 86: 103.

26. Penninger J M, Sirard C, Mittrücker H W, Chidgey A, Kozieradzki I, Nghiem M, Hakem A, Kimura T, Timms E, Boyd R, Taniguchi T, Matsuyama T, Mak T W. 1997. The interferon regulatory transcription factor IRF-1 controls positive and negative selection of CD8⁺ thymocytes. Immunity 7: 243.

27. Taki S, Sato T, Ogasawara K, Fukuda T, Sato M, Hida S, Suzuki G, Mitsuyama M, Shin E H, Kojima S, Taniguchi T, Asano Y. 1997. Multistage regulation of Th1-type immune responses by the transcription factor IRF-1. Immunity 6: 673.

28. McElligott D L, Philips J A, Stillman C A, Koch R J, Mosier D E, Hobbs M V. 1997. CD4⁺ T cells from IRF-1-deficient mice exhibit altered patterns of cytokine expression and cell subset homeostasis. J. Immunol. 159: 4180.

29. Kamijo R, Harada H, Matsuyama T, Bosland M, Gerecitano J, Shapiro D, Le J, Koh S I, Kimura T, Green S J, Mak T W, Taniguchi T, Vilcek J. 1994. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 263: 1612.

30. Ogasawara K, Hida S, Azimi N, Tagaya Y, Sato T, Yokochi-Fukuda T, Waldmann T A, Taniguchi T, Taki S. 1998. Requirement for IRF-1 in the microenvironment supporting development of natural killer cells. Nature 391: 700.

31. Hooghe R, Delhase M, Vergani P, Malur A, Hooghe-Peters E L. 1993. Growth hormone and prolactin are paracrine growth and differentiation factors in the haemopoietic system. (Review) Immunol. Today 14: 212.

32. Montgomery D W, Krumenacker J S, Buckley A R. 1998. Prolactin stimulates phosphorylation of the human T-cell antigen receptor complex and ZAP-70 tyrosine kinase: a potential mechanism for its immunomodulation. Endocrinology 139: 811.

33. Sorin B, Goupille O, Vacher A M, Paly J, Djiane J, Vacher P O. 1998. Distinct cytoplasmic regions of the prolactin receptor are required for prolactin-induced calcium entry. J. Biol. Chem. 273: 28461.

34. Horseman N D, Zhao W, Montecino-Rodriguez E, Tanaka M, Nakashima K, Engle S J, Smith F, Markoff E, Dorshkind K. 1997. Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO J. 16: 6926.

35. Bouchard B, Ormandy C J, Di Santo J P, Kelly P A. 1999. Immune system development and function in prolactin receptor-deficient mice. J Immunol. 163: 576.

36. Matera L, Bellone G, Lebrun J J, Kelly P A, Hooghe-Peters E L, Di Celle P F, Foa R, Contarini M, Avanzi G, Asnaghi V. 1996. Role of prolactin in the in vitro development of interleukin-2-driven anti-tumoural lymphokine-activated killer cells. Immunology 89: 619.

37. Nagy E, Berczi I. 1991. Hypophysectomized rats depend on residual prolactin for survival. Endocrinology 128: 2776.

38. Weimann E, Baixeras E, Zamzami N, Kelly P. 1999. Prolactin blocks glucocorticoid induced cell death by inhibiting the disruption of the mitochondrial membrane. Leuk. Res. 23: 751.