ARTICLE
INTRODUCTION
IL-6 is a 26-kDa, multifunctional cytokine inducing diverse biological
responses from various hemopoietic and nonhemopoietic cells. It has been
shown that IL-6-deficient mice develop normally, but they have reduced
T-lymphocyte numbers, and their antiviral and antibacterial immune responses,
as well as acute phase responses to infection and tissue damage, are severely
impaired [1].
During embryogenesis, pregnancy and finally at term, IL-6 also has an
important role. Human IL-6 stimulates early differentiation of murine
embryonic stem cells in vitro [2] and several studies have shown
its role in early embryonic hematopoietic development [3, 4]. Research
on different neuronal populations has revealed that IL-6 also has some
neurotrophic activity [5]. It has various actions that may be relevant
to tissue remodeling and activity of leukocytes in the uterus during pregnancy
[6]. Furthermore, it has been suggested that uterine IL-6 could act as
an important mediator of normal term labour; together with IL-1beta and
TNF-alpha, IL-6 induces prostaglandin release from uterine tissues leading
to myometrial contractions and delivery [7]. This is in line with the
previous finding that in pregnant women serum levels of IL-6 increase
with gestational age [8].
Various cell types are reported to contribute to IL-6 production in
the uterus; epithelial and stromal cells, placental trophoblast cells
[6] and amnion cells [9]. It is not clear when a human fetus is able to
secrete
IL-6, but at least first-trimester human chorionic villi are capable of
a moderate expression of IL-6 mRNA [10]. In mice, IL-6 has been reported
to be expressed as early as at the blastocyst-stage embryo and in the
thymus from fetal day 14 [11, 12]. Elevated levels of IL-6 in amniotic
fluid have been measured in preterm labours with and without infection
[13, 14].
Previous studies in adults and in neonates have demonstrated the important
role of IL-6 in the pathogenesis of the sepsis syndrome [15-17]. Results
from in vitro and in vivo studies of the capacity of neonates
to produce IL-6 have been contradictory. Reduced or similar levels of
IL-6 have been observed in stimulated neonatal cells as compared to stimulated
adult cells [18-20]. However, plasma levels of IL-6 in septic neonates
seem to be greatly elevated as found in septic adults [15-17]. To date,
there are only a few studies involving both in vivo and in vitro
production of IL-6 by neonates [21].
IL-6 is a single-copy gene located on chromosome 7p21. Within the regulatory
region of this gene occur polymorphic sites and at least one of these
is associated with an altered rate of expression of the IL-6 gene. Fishman
et al. [22] reported that a G/C polymorphism at position -174 in
the promoter region could affect the transcription rate of a reporter
gene in transient transfection studies, and that this could be associated
with the different IL-6 responses to stressful stimuli.
To analyse the role of the G/C polymorphism at position -174 in the
function of the IL-6 gene, we examined the cord blood plasma IL-6 levels
in neonates in relation to the presence of the IL-6G and IL-6C alleles.
We assumed that the normal labour-related stress provides a physiological
stimulus for cytokine production. We also considered that the cytokine
plasma levels from cord blood are worth studying, since healthy neonates
lack previous exposure to exogenous antigens, and their native cytokine
production could be primarily driven by their genetic information.
MATERIALS AND METHODS
Subjects
Cord blood was collected from umbilical veins of 50 healthy, full-term
newborns after normal vaginal delivery and from umbilical veins of 42
healthy, full-term neonates after elective caesarean section (collection
was kindly performed by the staff of the Department of Obstetrics, Tampere
University Hospital, Finland). Previous delivery by caesarean section,
poor presentation, disproportion, fear of delivery and placenta praevia
were indications for elective caesarean sections, in order of frequency.
Collected cord blood samples were analysed only if they met evaluation
criteria. Evaluation consisted of health and the medication of mothers,
the nationality of parents and a gestational age and Apgar scores of neonates.
All 450 adult blood samples were obtained from the Finnish Red Cross Blood
Transfusion Centre, Tampere. The donors were adults (18-60 years old)
and, according to the information on questionnaires, they had had no blood-transmitted
diseases or any signs of other infections during a 2-week period prior
to the blood donation. Samples were collected into plastic tubes treated
with citrate. From the blood samples, plasma was separated, aliquoted
and stored at - 20° C until further use. From the remaining blood,
the mononuclear cells were isolated by Ficoll-Isopaque centrifugation
(Pharmacia, Uppsala, Sweden). The approval for human blood use was given
by the ethics board of the Finnish Red Cross Blood Transfusion Centre.
Analysis of IL-6 gene polymorphism
Genomic DNA was isolated from the mononuclear cells using the salting
out method [23]. The IL-6 promoter polymorphism at position -174 was analyzed
as previously described [22]. Briefly, oligonucleotides 5'TGACTTCAGCTTTACTCTTGT3'
and 5'CTGATTGGAAACCTTATTAAG3' were used as primers in the polymerase chain
reaction (PCR). Conditions used were: five cycles of 96° C for 9
min, 55° C for 1 min and 72° C for 3 min, followed by 30 cycles
of 95° C for 1 min, 55° C for 1 min and 72° C for 1 min,
with a final incubation at 72° C for 10 min. The PCR products were
digested with 5 units of NlaIII at 37° C for 24 hours and
analyzed on a 9% polyacrylamide gel stained with ethidium bromide. This
generated fragments of 119 bp + 49 bp for allele 2 and a single fragment
of 168 bp for allele 1.
Measurement of IL-6 plasma levels
Cord blood IL-6 plasma levels after normal vaginal delivery (N = 50),
after elective caesarean section (N = 42) and adult IL-6 plasma levels
(N = 400) were measured using an enzyme-linked immunosorbent assay (ELISA;
CLB, Pelikine Compact human IL-6 ELISA kit, Amsterdam, The Netherlands).
The sensitivity of the assay was 0.2-0.4 pg/ml and the assay was performed
according to the manufacturer's instructions.
Measurement of IL-6 production
IL-6 production in vitro was analyzed in 50 cord blood and 50
adult blood samples. Unstimulated and LPS-stimulated mononuclear cells
(106 cells/ml and 1 ml/well) were incubated at 37° C for
24 hours. LPS was used at a final concentration of 1 mug/ml. The cells
were then harvested and the supernatants were collected and stored at
- 20° C. IL-6 levels were measured as described above.
Data analysis
Statistical methods appropriate for non-parametric data were used throughout.
The Mann-Whitney U-test and the Kruskal-Wallis test were used to test
for significant associations between IL-6 production and IL-6 genotypes,
and a test value of p < 0.05 was considered significant. Statistical
calculations were performed using SPSS for Windows, version 6.1 (SPSS
Inc., Chicago, Illinois, USA). The Hardy-Weinberg equations were calculated
using the Arlequin program, version 1.1 (Genetics and Biometry Lab, University
of Geneva, Switzerland).
RESULTS
C allele frequency
The IL-6 genotype frequencies were in Hardy-Weinberg equilibrium. The
frequencies of the C allele in neonates born by vaginal delivery (N =
50) and in neonates born by elective caesarean section (N = 42) were comparable
with the frequencies found in the two adult groups (N = 400 and N = 50);
respective values were 0.52, 0.61, 0.55 and 0.54. There is a previous
study on a G/C polymorphism at position -174 of the IL-6 gene where the
authors found a C allele frequency of 0.40 in a group of 383 healthy males
and females in the United Kingdom [22].
IL-6 plasma levels
Our results demonstrated that IL-6 plasma levels in neonates were significantly
higher than those in adults (neonates born by VD versus adults
p < 0.001 and neonates born by ECS versus adults p < 0.001);
the median value for neonates born by VD was 11.4 pg/ml (4.5-45.9), for
neonates born by ECS it was 2.9 pg/ml (1.9-6.4) and for adults, 1.2 pg/ml
(0.7-2.0) (Figure 1). It was
also observed that newborns born by VD had significantly higher IL-6 plasma
levels than those born by ECS (p < 0.001) (Figure
1). This finding suggests that normal labour-related stress could
induce IL-6 production in newborns.
An analysis was carried out to ascertain if there was a genetic association
between different IL-6 genotypes and IL-6 plasma levels in neonates. It
was noticed in the group of VD, that CC genotypes had increased
IL-6 plasma levels compared with GC or GG genotypes (p = 0.08); respective
median values were 21.4 pg/ml (9.5-81.3), 9.7 pg/ml (3.4-46.3) and 6.0
pg/ml (3.5-24.5). This finding was also confirmed when the comparison
was made according to the carrier status. Non-carriers of the G allele
secreted significantly more IL-6 than carriers of the G allele (p <
0.03) (Figure 2); 21.4 pg/ml
(9.5-81.3) and 9.6 pg/ml (3.5-36.2). Furthermore, section newborns with
genotype CC had higher IL-6 plasma levels than carriers of the G allele
(p < 0.02); respective median values were 6.3 pg/ml (2.2-12.9) and
2.7 pg/ml (1.7-4.1). No association was found between IL-6 plasma levels
and different IL-6 genotypes in the adult controls (Figure
3).
IL-6 production after LPS stimulation
Next, our in vivo results were confirmed with in vitro
experiments. The results again suggested that after LPS stimulation, the
mononuclear cells of neonates of the CC genotype secreted more IL-6 than
those of the GC or GG genotype (p = 0.05); the median value for CC genotypes
was 17,425 pg/ml (11,400-33,900), for GC genotypes 14,000 pg/ml (3,260-22,725),
and for GG genotypes 5,850 pg/ml (4,535-11,365). This finding was also
supported when IL-6 production was compared between carriers of the G
allele and non-carriers of the G allele. IL-6 levels were significantly
lower in carriers of the G allele than in non-carriers (p < 0.04);
respective median values were 6,980 pg/ml (4,175-16,800) and 17,425 pg/ml
(11,400-33,900) (Figure 4). There
was no difference in IL-6 production by adult cells between carriers of
the G allele G and non-carriers of the G allele (p = 0.68) (Figure
5). IL-6 production by neonatal or unstimulated adult cells was not
associated with the IL-6 -174 polymorphism.
Additionally, we observed that unstimulated adult cells secreted spontaneously
more IL-6 than neonate (p < 0.03) (Figure
6); the median value for adult cells was 621 pg/ml (211-1,470) and
the median value for newborn cells was 271 pg/ml (93-977). However, after
LPS stimulation mononuclear cells from neonates produced amounts of IL-6
comparable with adult cells (p = 0.15) (Figure
6); the corresponding median values were 13,100 pg/ml (4,594-22,875)
and 10,380 pg/ml (3,740-14,750).
DISCUSSION
The aim of this study was to determine the capacity of newborns to produce
IL-6 in vivo and in vitro. In most of the studies so far,
the detection of the IL-6 secretion ability of neonates has been performed
either by measuring plasma levels or by measuring the cellular production
after stimulation in vitro. We also wanted to find out whether
this naive IL-6 response of newborns was associated with a promoter polymorphism
of the IL-6 gene.
The first finding of this study was the significantly higher cord blood
IL-6 plasma levels after vaginal delivery compared with those after elective
caesarean section (p < 0.001); the median value for neonates born by
VD was 11.4 pg/ml (4.5-45.9) and the median value for neonates born by
ECS was 2.9 pg/ml (1.9-6.4). Increased IL-6 plasma levels after VD suggest
that the normal labour-related stress by itself provides a physiological
stimulus for IL-6 production. Various factors during a normal delivery
may induce IL-6 secretion in neonates. IL-6 is produced in response to
other cytokines, such as TNF-alpha and IL-1. These cytokines are present
in the cord blood of healthy, full-term neonates [16] and increased levels
of these cytokines have also been found in the circulation and in the
amniotic fluid of women in labour [24]. After membrane rupture, a neonate
is exposed to a variety of aerobic and anaerobic bacteria in the mother's
genital tract. This may be one of those mechanisms stimulating the release
of IL-6 in newborns, since bacterial products, for example lipopolysaccharide
(LPS) of gram negative bacteria, are potent stimulators of IL-6 production.
Actually, this exposure of newborns may occur even earlier, since Romero
et al. [25] showed that nearly 20% of women at term have subclinical
microbial invasion of the amniotic cavity. On the other hand, it has been
observed that IL-6 is increased by physical activity [26] and that the
physical strain of labour is associated with the IL-6 concentration in
maternal serum [27]. Thus, it is not surprising that the physical stress
of labour also effects cytokine plasma levels in cord blood. In line with
our results, Opsjon et al. and Buonocore et al. found higher
IL-6 plasma levels in mothers and their newborns after normal vaginal
delivery than in mothers and babies after elective caesarean section [24,
28].
Since IL-6 is a proinflammatory cytokine that is normally tightly regulated
and expressed at low levels except during infection, trauma or other stress
[29], low IL-6 levels of adult controls were not surprising. However,
ECS newborns without normal labour-related stress had significantly elevated
IL-6 levels compared to those of adult controls (p < 0.001). Although
there are not enough data available on fetal production of IL-6 during
advanced pregnancy, the observation may reflect the involvement of IL-6
in an inflammation-like process at a normal term [7, 8]. Similarly, the
increased concentrations of inflammatory cytokines were measured healthy
neonates during the perinatal period [30]. The design of the present study
does not allow any conclusions as to whether elevated levels of IL-6 in
cord blood reflect those found in maternal serum. Present data on the
transfer of cytokines through the placenta in both materno-fetal and feto-maternal
directions are contradictory [16, 24, 31]. Berner et al. [16] have
demonstrated that plasma levels of proinflammatory cytokines were significantly
higher in the cord blood of septic infants than the corresponding maternal
levels. The observation suggests that only very small amounts of cytokines
may be transferred through the placenta. Accordingly, no association was
observed between the amount of IL-6 in amniotic fluid or maternal or cord
sera in data from Opsjon et al. [24]. In contrast, De Jongh et
al. found a significant positive correlation between cord blood IL-6
levels and maternal serum IL-6 levels [31], although this finding does
not exclude endogenous IL-6 production by healthy newborns. Our in
vitro data also suggest that neonates are capable of producing IL-6;
neonatal mononuclear cells secreted large amounts of IL-6 after LPS-stimulation
(Figure 6). Further studies are
required to find out whether this increased endogenous IL-6 production
of neonates has some physiological significance.
Additionally we noted that IL-6 levels varied widely between neonates;
a range of IL-6 levels of 1.2-625 pg/ml in neonates born by VD, and 0-424
pg/ml in neonates born by ECS were observed. All cord blood samples were
collected from mature neonates, who were healthy at the time of delivery
and who were delivered without signs of maternal infection or maternal
or peripartal risk factors. In a quite similar study involving 35 cord
blood samples, a range of
IL-6 plasma values 0.4-897 pg/ml [16] was found, which is similar to our
range of values. Furthermore, it had been observed previously that a wide
range of IL-6 values is found particularly in sepsis patients [15-17,
32] and that the magnitude of the increase of IL-6 levels correlates with
mortality [15]. Taken together, it becomes tempting to suggest that this
wide variation of IL-6 plasma values in stress conditions could be explained
by genetic factors. Austgulen et al. also reported a wide variation
of soluble IL-6 receptors (IL-6Rs) in the serum of healthy pregnant women,
and that these differences of individual IL-6Rs levels remained constant
through-out the pregnancy period [8].
The C allele frequencies in our study groups (0.52-0.61) were slightly
different from those published earlier [22] in a group of 383 healthy
males and females in the United Kingdom (0.40), probably reflecting the
interethnic variation in the frequencies of this polymorphism. Although
in the same study Fishman et al. [22] demonstrated that IL-6 levels
were lower in healthy adults with the CC genotype compared with GC or
GG subjects, we could not find an association between IL-6 production
and this polymorphism of the IL-6 gene in adult controls.
CONCLUSION
Our results suggest that the -174 polymorphism of the IL-6 gene participates
in the regulation of the IL-6 response in neonates; IL-6 plasma levels
and IL-6 secretion after stimulation were increased in neonates with the
CC genotype. Since this polymorphic site was not associated with the baseline
and inducible IL-6 levels of adults, the present study suggests the occurrence
of a different regulation mechanism of the IL-6 response in the cells
of neonates and in the cells of healthy adults. The underlying mechanism
for this difference is not clear. One possible explanation for this phenomenon
could be the naive immune system of a neonate. Our in vitro data
indicated that the repeatedly stimulated adult cells spontaneously secreted
more IL-6 than the naive neonatal cells (Figure
6). Cytokine gene expression is usually tightly controlled at the
level of transcription by the co-ordinated binding of multiple transcription
factors to regulatory elements in the promoter region. Although those
factors binding at position -174 of the IL-6 gene are not known, there
are probably differences in factors in naive neonatal cells and in repeatedly
stimulated adult cells. Additionally, recent results have shown that the
relationship between cytokine expression and the single polymorphic site
is not as simple as might be expected; rather than a single polymorphic
site it may be the combination of base changes at several sites on the
promoter, i.e. the haplotype, that has effect on IL-6 expression
[33]. It also seems obvious that there is a cell type and stimulation-specific
regulation of IL-6 expression. Thus, it is highly unlikely that the C
allele of the -174 polymorphism alone represents the susceptibility site
for increased IL-6 production in neonates and more likely that it may
interact with other sites on the IL-6 promoter to produce the increased
production of IL-6.
Acknowledgments. This work was supported by grants from the Research
Fund of Tampere University Hospital. The authors would like to thank Mrs
Sinikka Repo-Koskinen and Mrs Mervi Salomäki for expert technical
assistance and the staff of the Department of Obstetrics, Tampere University
Hospital for providing the cord blood samples.
REFERENCES
1. Kopf M, Baumann H, Freer G, Freudenberg M, Lamers M, Kishimoto T,
Zinkernagel R, Bluethmann H, Kohler G. 1994. Impaired immune and acute-phase
responses in interleukin-6-deficient mice. Nature 368: 339.
2. Biesecker L G, Emerson S G. 1993. Interleukin-6 is a component of
human umbilical cord serum and stimulates hematopoiesis in embryonic stem
cells in vitro. Exp. Hematol. 21: 774.
3. Fennie C, Cheng J, Dowbenko D, Young P, Lasky L A. 1995. CD34+
endothelial cell lines derived from murine yolk sac induce the proliferation
and differentiation of yolk sac CD34+ hematopoietic progenitors.
Blood 86: 4454.
4. Palacios R, Golunski E, Samaridis J. 1995. In vitro generation
of hematopoietic stem cells from an embryonic stem cell line. Proc.
Natl. Acad. Sci. USA 92: 7530.
5. Moroni S C, Rossi A. 1995. Enhanced survival and differentiation
in vitro of different neuronal populations by some interleukins.
Int. J. Dev. Neurosci. 13:41.
6. Robertson S A, Seamark R F, Guilbert L J, Wegmann T G. 1994. The
role of cytokines in gestation. (Review) Crit. Rev. Immunol. 14:239.
7. Steinborn A, Kühnert M, Halberstadt E. 1996. Immunomodulating
cytokines induce term and preterm parturition. J. Perinat. Med.
24: 381.
8. Austgulen R, Lien E, Liabakk N, Jacobsen G, Arntzen K J. 1994. Increased
levels of cytokines and cytokine activity modifiers in normal pregnancy.
Eur. J. Obstet. Gynecol. Reprod. Biol. 57: 149.
9. Keelan J A, Sato T, Mitchell M D. 1997. Interleukin (IL)-6 and IL-8
production by human amnion: regulation by cytokines, growth factors, glucocorticoids,
phorbol esters and bacterial lipopolysaccharide. Biol. Reprod.
57: 1438.
10. Bennett W A, Lagoo-Deenadayalan S, Stopple J A, Barber W H, Hale
E, Brackin M N, Cowan B D. 1998. Cytokine expression by first-trimester
human chorionic villi. Am. J. Reprod. Immunol. 40: 309.
11. Rothstein J L, Johnson D, DeLoia J A, Skowronski J, Solter D, Knowles
B. 1992. Gene expression during preimplantation mouse development. Genes
Dev. 6: 1190.
12. Montgomery R A, Dallman M J. 1991. Analysis of cytokine gene expression
during fetal thymic ontogeny using the polymerase chain reaction. J.
Immunol. 147: 554.
13. Foulon W, Van Liedekerke D, Demanet C, Decatte L, Dewaele M, Naessens
A. 1995. Markers of infection and their relationship to preterm delivery.
Am. J. Perinat. 12: 208.
14. Arntzen K J, Kjollesdal A M, Halgunset J, Vatten L, Austgulen R.
1998. TNF, IL-1, IL-6, IL-8 and soluble TNF receptors in relation to chorioamnionitis
and premature labour. J. Perinat. Med. 26: 17.
15. Casey L C, Balk R A, Bone R C. 1993. Plasma cytokine and endotoxin
levels correlate with survival in patients with the sepsis syndrome. Ann.
Intern. Med. 119: 771.
16. Berner R, Niemeyer C M, Leititis J U, Funke A, Schwab C, Rau U,
Richter K, Tawfeek M S, Clad A, Brandis M. 1998. Plasma levels and gene
expression of granulocyte colony-stimulating factor, tumour necrosis factor-alpha,
interleukin (IL)-1beta, IL-6, IL-8 and soluble intercellular adhesion
molecule-1 in neonatal early onset sepsis. Pediatr. Res. 44: 469.
17. Messer J, Eyer D, Donato L, Gallati H, Matis J, Simeoni U. 1996.
Evaluation of interleukin-6 and soluble receptors of tumor necrosis factor
for early diagnosis of neonatal infection. J. Pediatr. 129: 574.
18. Vallejo J G, Baker C J, Edwards M S. 1996. Interleukin-6 production
by human neonatal monocytes stimulated by type III group B streptococci.
J. Infect. Dis. 174: 332.
19. Schibler K R, Liechty K W, White W L, Rothstein G, Christensen R
D. 1992. Defective production of interleukin-6 by monocytes: a possible
mechanism underlying several host deficiencies of neonates. Pediatr.
Res. 31: 18.
20. Müller K, Zak M, Nielsen S, Pedersen F K, de Nully P, Bendtzen
K. 1996. In vitro cytokine production and phenotype expression
by blood mononuclear cells from umbilical cords, children and adults.
Pediatr. Allergy Immunol. 7: 117.
21. Pillay V, Savage N, Laburn H. 1994. Circulating cytokine concentrations
and cytokine production by monocytes from newborn babies and adults. Pflug.
Arch. 428: 197.
22. Fishman D, Faulds G, Jeffery R, Mohamed-Ali V, Yudkin J S, Humphries
S, Woo P. 1998. The effect of novel polymorphisms in the interleukin-6
(IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association
with systemic-onset juvenile chronic arthritis. J. Clin. Invest.
102: 1369.
23. Miller S A, Dykes D D, Polesky H F. 1988. A simple salting out procedure
for extracting DNA from human nucleated cells. Nucleic Acids Res.
16: 1215.
24. Opsjln S, Wathen N C, Tingulstad S, Wiedswang G, Sundan A, Waage
A, Austgulen R. 1993. Tumor necrosis factor, interleukin-1 and interleukin-6
in normal human pregnancy. Am. J. Obstet. Gynecol. 169: 397.
25. Romero R, Nores J, Mazor M, Sepulveda W, Oyarzun E, Parra M, et
al. 1993. Microbial invasion of the amniotic cavity during term labour.
Prevalence and clinical significance. J. Reprod. Med. 38: 543.
26. Papanicolaou D, Petrides J, Tsigos C, Bina S, Kalogeras K, Wilder
R, Gold P W, Deuster P A, Chrousos G P. 1996. Exercise stimulates interleukin-6
secretion: inhibition by glucocorticoids and correlation with catecholamines.
Am. J. Physiol. 271: E601.
27. Arntzen K J, Lien E, Austgulen R. 1997. Maternal serum levels of
interleukin-6 and clinical characteristics of normal delivery at term.
Acta Obstet. Gynecol. Scand. 76: 55.
28. Buonocore G, De Flippo M, Gioia D, Picciolini E, Luzzi E, Bocci
V, Bracci R. 1995. Maternal and neonatal plasma cytokine levels in relation
to mode of delivery. Biol. Neonate 68: 104.
29. Ershler W B, Keller E T. 2000. Age-associated increased interleukin-6
gene expression, late-life diseases, and frailty. (Review) Annu. Rev.
Med. 51: 245.
30. Sarandakou A, Giannaki G, Malamitsi-Puchner A, Rizos D, Hourdaki
E, Protonotariou E, Phocas I. 1998. Inflammatory cytokines in newborn
infants. Mediators Inflamm. 7: 309.
31. De Jongh R F, Puylaert M, Bosmans E, Ombelet W, Maes M, Heylen R.
1999. The fetomaternal dependency of cord blood interleukin-6. Am.
J. Perinatol. 16: 121.
32. Heney D, Lewis I, Evans S W, Banks R, Bailey C C, Whicher J T. 1992.
Interleukin-6 and its relationship to C-reactive protein and fever in
children with febrile neutropenia. J. Infect. Dis. 165: 886.
33. Terry C F, Loukaci V, Green F R. 2000. Cooperative influence of
genetic polymorphisms on interleukin-6 transcriptional regulation. J.
Biol. Chem. 275: 18138.
|
Version imprimable
