ARTICLE
Auteur(s) : Kaiming Zhang, Ruili Zhang,
Xinhua Li, Guohua Yin, Xuping Niu
Institute of Dermatology, Taiyuan City Centre Hospital,
Affiliated to Shanxi Medical University, No.1 Dong San Dao
Taiyuan City, Shanxi Province 030009, P.R. China
accepté le 19 Novembre 2008
Psoriasis is a common and enigmatic inflammatory skin disorder
that affects approximately 2% of the world’s population. Compelling
circumstantial and experimental evidence suggests a primary
immunopathogenesis based on T-cell dysregulation [1-3]. Pathogenic
T lymphocytes, along with the relative dominance of type 1 helper T
(Th1) cytokines, e.g. interferon- and interleukin-2 and reduced
levels of anti-inflammatory cytokines, e.g. interleukin-4 and
interleukin-10, play a critical role in the formation of psoriatic
lesions, by triggering the chain reactions of cellular and
molecular networks [4-8]. In addition, psoriasis shows a wide
variety of immune abnormalities, not only concerned with T cells,
but also with various other immunocytes, such as B cells,
monocytes, neutrophils, as well as erythrocytes [9-11]. The
cytokines secreted by these cells add to a milieu with mediator
imbalance. Bone marrow, with its rapidly renewing cell populations,
is one of the most sensitive tissues to various stimulation of
exogenous or endogenous factors [12]. It is tempting to speculate
that the dysfunctional immunity may influence the hematopoietic
microenvironment, or hematopoiesis, in psoriasis. In fact,
retroactively, abnormal monocytopoietic activity has been
demonstrated in psoriasis functional bone marrow scintigraphy [13,
14]. The high proliferative potential colony-forming cell
(HPP-CFCs) assay was a preferable model for investigating the
content of hematopoietic stem cells (HSCs), their responsiveness to
hematopoiesis growth factors and to activities of proliferation and
differentiation [15, 16]. In vitro assessment using HPP-CFCs
colony-forming assays as a surrogate marker of hematopoietic
activity could play a key role in linking hematopoiesis to
psoriasis [17].
In human cells, cell cycle progression is tightly regulated by a
series of phosphorylation events, which involves Cdks and
Dbf4/ASK-dependent Cdc7 kinase [18-21]. At G1 to S phase
transition, Cdk4/6-cyclin D and Cdk2-cyclin E phosphorylate Rb and
liberate E2F [22-25], which can promote transcription of various
cell cycle regulators. The P15 and P21 proteins all belong to the
INK4 kinase family of cyclin-dependent kinase inhibitors, and they
negatively regulate the cell cycle through competitive inhibition
of the cyclin-dependent kinases 2, 4 and 6, involved in
Rb-dependent cell cycle regulation. The major inactivity mechanism
of p15 and p21 genes is methylation of the 5′ promoter region of
the gene, which leads to transcription silencing [26-29]. So the
promoter methylation status of p15 and p21 genes is suggested to be
responsible for regulating proliferation activity of Bone
marrow haematopoietic cells (BMHCs). However, to our
knowledge, no direct experimental evidence has been provided on
this line of thought.
In this study, we determined promoter methylation status and
mRNA expression of p15 and p21 genes in HPP-CFCs of psoriatic
patients, to reveal the potential mechanisms of abnormal activity
of BMHCs in psoriasis.
Materials and methods
Patients
Twenty-four patients (14 males, 10 females, ages 15-68y, median
35.2y) with chronic plaque type psoriasis affecting at least 10% of
their total body surface area and 24 healthy volunteers (11 males,
13 females, ages 19-65y, median 32.2y) without significant renal,
hepatic, or other medical disease, were enrolled in the study.
A medication–free period of at least 1 month for systemic
agents for treating psoriasis was required in both groups before
the procedures. The protocols involving human subjects were
approved by the Medical Ethics Committee of Taiyuan City Centre
Hospital. After written informed consents were obtained, 5 mL
bone marrow was obtained by osteostixis at the posterior superior
iliac spine and anticoagulated using 20 U/mL heparin as
anticoagulant.
CD34+ cell frequency assay
Bone marrow mononuclear cells (BMMNCs) were separated from
anticoagulated bone marrow derived from the psoriatic patients and
normal volunteers by density gradient centrifugation on Ficoll
(Ficoll,1.077,Sigma) within 12 hours of collection, and the
remaining erythrocytes were lysed using 0.15 mol·L-1
Tris-ammonium chloride. Approximately 1 × 106 cells for
each experiment were incubated for 30min at 4 °C in the
culture medium, with anti-CD34-FITC (BD Biosciences). After washing
the cells with PBS/1% BSA (Sigma-Aldrich), they were analyzed by
flow cytometry.
HPP-CFCs colony formation assays
BMMNCs were incubated in IMDM supplemented with 20% fetal bovine
serum (FBS, Sigma) and seeded into 24-well flat-bottomed
micro-titer plates (GIBCO) at a density of 2 ×
105mL-1 in a total volume of 0.5 mL IMDM
culture medium supplemented with 0.9% methylcellulose (Aldrich
Chemical; Milwaukee, WI), 30% FBS, 1% deionized bovine serum
albumin (BSA, Sigma), 5 × 10-5M 2-mercaptoethanol (2-ME,
Sigma), pre-tested 10% hydrocortisone hemisuccinate
(10-6M final concentration, Sigma), as well as
hematopoietic growth factors, containing 50 ng·mL-1
rhSCF, 50 ng·mL-1 rhGM-CSF,
100 U·mL-1 rhIL-3, 100 U·mL-1
rhIL-6, R&D Systems,and 2 U·mL-1 rhEpo (R&D
Systems) for 2 weeks.The colonies larger than 0.5 mm in size
were scored by using an inverted microscope as HPP-CFC colonies and
chosen for harvesting.
Proliferation Assays of HPP-CFCs
In some experiments, HPP-CFCs were collected and incubated at the
density of 2 × 105/mL for 48 hours in round-bottom,
96-well plates. The culture supernatants were removed and then
20 μL 5 mg/mL MTT solution and 180 μL serum-free
medium were added to the wells. After a 4 hour incubation, the
supernatant was removed gently, 200 μL DMSO per well was
added, and the plates were put on vibration for 10 minutes.
The optical density per well was determined by Multiscan MS
(Labsystems, Finland) as the proliferation values of respective
HPP-CFCs.
Semi-quantitative RT-PCR for p15 and p21 mRNA
expression
For semi-quantitative analysis, total RNA was extracted from
HPP-CFCs of healthy volunteers or psoriatic patients using a Trizol
kit (Life Technologies. Corp, USA), First-strand cDNA was generated
at 42°C from 3 μg of total RNA with random primers and reverse
transcriptase (MMLV RNase H reverse transcriptase; BBI Corp.,
Gaithersburg, MD, USA) in accordance with the manufacturer’s
protocol. With a housekeeping gene, human β-actin, as internal
control, mRNA expression of p15 or p21 gene was amplified in a
25 μL total reaction volume containing 5 μL cDNA,
2.5 μL 10× PCR buffer, 1.5 mmol/L MgCl2, 1 μL of
10 mol/L dNTPs, 1 μL p15 or p21 primers, 1 μL
β-actin primers, and 2.5 U Taq polymerase (AmpliTaq Gold). The
primers are listed in table 1. The
thermocycler parameters were 95 °C for 10 min, followed
by 40 cycles of 95 °C for 15 s, 60°C for 1 min and
72 °C for 30s. Finally, a 10 μL sample of the PCR product
was loaded onto a 2% agarose gel, stained with ethidium bromide,
and visualized under ultraviolet light. Gel ultraviolet images were
grabbed and the optical density of each target band was analyzed by
gel documentation analysis system (GDS8000; UVP Inc. California,
USA). The relative quantity of p15 or p21 was calibrated by
comparing the expression of each target to β-actin.
Table 1 PCR primers used for MSP or RT-PCR
|
Primers
|
Sense primer 5′→3′
|
Antisense primer 5′→3′
|
Size (bp)
|
|
p15-RT
|
GGAATGGGCGAGGAGAACAAGGGCATG
|
ATAAGCTTGGCGTCAGTCCCCCGTGGCT
|
428
|
|
p21-RT
|
GTGGACCTGTCACTGTCTTGTAC
|
CTTCCTCTTGGAGAAGATCAGC
|
163
|
|
β-actin
|
CTACAATGAGCTGCGTGTGGC
|
CAGGTCCAGACGCAGGATGGC
|
270
|
|
p15-M
|
GATCGGTCGTTCGGTTATTG
|
CTTATTCTCGCGCATTC
|
207
|
|
p15-U
|
GTTGTTTGGTTATTGTATGGG
|
CCCTTATTCTCCTC CAC AT
|
204
|
|
p21-M
|
TACGCGAGGTTTCGGGATCG
|
AAAACGACCCGCGCTCG
|
133
|
|
p21-U
|
TATGTGAGGTTTTGGGATTGG
|
AAAAACAACCCACACTCAACC
|
133
|
Methylation-Specific Polymerase Chain Reaction (MS-PCR)
DNA of HPP-CFCs from psoriatic patients and normal controls was
extracted using the Genomic DNA Purification Kit (Promega Corp.)
using standard protocols. 2 μg genomic DNA was denatured by
treatment with NaOH and modified by sodium bisulfite to convert all
unmethylated cytosines to uracils while leaving methylated
cytosines unaffected. The samples were then purified using Wizard
DNA purification resin (Promega, Madison, WI), treated with NaOH,
recovered in ethanol and re-suspended in 30 μL of distilled water.
MS-PCR for p15 and p21 promoter methylation was performed as
described previously [30, 31]. Each sample was amplified with two
sets of primers for methylated DNA (methylated MS-PCR) and
unmethylated DNA (unmethylated MS-PCR) respectively. The primers
used for the methylated and unmethylated p15 and p21 gene promoter
regions were as reported previously (table
1). The methylated DNA isolated from peripheral blood,
modified by sodium bisulfite and dealt with Sss-I methylase was
used as positive control. The PCR mixture contained 100 ng of
bisulfite-treated DNA, 0.2 mmol/L of deoxynucleoside triphosphate,
1.5 mmol/L of MgCl2, 50 pmol of each primer, 1 × PCR
Buffer, and 2.5 units of AmpliTaq Gold in a final volume of 25 μL.
PCR was performed in PTC-100 Programmable Thermal Controller
(MJResearch Inc., Waltham, Massachusetts, USA). The PCR products
were analyzed by agarose gel electrophoresis and ethidium bromide
staining. For each amplification, a positive control was included.
PCR conditions for the four sets of reactions were as follows:
95 °C for 10 minutes; then 40 cycles at 95 °C for 1
minute, 61 °C for 1 minute, and 72 °C for 1 minute; and a
final extension of 10 minutes at 72 °C. Finally, 10 μL of PCR
products were loaded onto 2% agarose gels, stained with ethidium
bromide, and visualized under ultraviolet light.
Statistical analysis
The results of HPP-CFCs assays are reported as mean ± standard
deviation in all assays and statistical analysis was performed
using two-sample/group t-test. mRNA expression of the p15 and p21
genes was analyzed by the Mann-Whitney Test. The Chi-square test
was used to compare the difference of the p15 and p21 gene promoter
methylation status, between psoriatic patients and normal controls.
Results
CD34+ cells are present with the same
frequency in BMMNC of healthy donors and patients
with psoriasis
We stained whole mononuclear cells from freshly drawn bone marrow
with anti-CD34-FITC. We analyzed the frequency of CD34+ cells in
both patients with psoriasis and control subjects. The mean
frequency was 3.4% ± 0.3 in the healthy control group and 3.2% ±
0.2 in the psoriasis patient group; no statistically significant
differences were found between the two populations by the two
sample t test (t = 0.38, P > 0.5).
HPP-CFC colony count of psoriatic patients
As shown, the methylcellulose semi-solid culture medium supplement
with various cytokines supported the in vitro proliferation or
expansion of more primitive progenitors, which gave rise to HPP-CFC
colonies (figure
1). A comparison of HPP-CFC colony formation of BMHC
from psoriatic patients and normal controls was carried out. The
results indicated a significantly lower colony formation capacity
of hematopoietic cells in psoriasis (9.17 ± 1.46) in comparison to
normal controls (13.75 ± 1.81) (figure 2A). Then, HPP-CFCs
from psoriatic patients or normal volunteers were examined for
their proliferation activity, using the MTT colorimetric assay. The
proliferation values of psoriatic patients (0.95 ± 0.12) were
significantly lower (p < 0.05) than those of normal controls
(1.26 ± 0.09). HPP-CFCs from psoriatic patients exhibited decreased
proliferation activity (figure 2B).
mRNA expression of p15 and p21 genes
in HPP-CFCs
Levels of the p15 and p21 transcripts were determined in HPP-CFC
samples by semi-quantitative RT-PCR analysis. A 428-bp
fragment of the p15 transcript and a 163-bp fragment of the p21
transcript were generated, respectively, with a 270-bp fragment of
the β-actin transcript co-amplified as the internal standard (figure 3). We
compared p15 or p21 mRNA expression in HPP-CFCs between normal
volunteers and psoriatic patients. The results shown in table 2 demonstrate that mRNA expression of p15 and
p21 genes in HPP-CFCs of psoriatic patients was significantly
higher (P = 0.026 for p15; P = 0.04 for p21) than that found in
normal controls.
Table 2 The relative quantity of p15 or p21 gene mRNA
in HPP-CFCs of normal volunteers (N) and psoriatic patients (P)
|
Sample
|
1
|
2
|
3
|
4
|
5
|
6
|
7
|
8
|
9
|
10
|
11
|
12
|
13
|
14
|
15
|
16
|
17
|
18
|
19
|
20
|
21
|
22
|
23
|
24
|
P
|
|
p15
|
N
|
1.02
|
0.53
|
0.00
|
0.00
|
0.86
|
1.56
|
0.00
|
1.20
|
0.00
|
1.90
|
0.90
|
0.00
|
0.00
|
0.00
|
2.14
|
0.86
|
0.91
|
0.00
|
0.00
|
1.31
|
1.51
|
1.02
|
0.00
|
0.00
|
0.026
|
|
P
|
0.00
|
1.23
|
1.64
|
2.30
|
1.65
|
1.98
|
1.06
|
1.35
|
0.00
|
1.56
|
1.36
|
2.16
|
2.34
|
1.65
|
1.23
|
0.00
|
0.00
|
0.00
|
1.25
|
0.98
|
0.65
|
0.00
|
0.00
|
1.67
|
|
p21
|
N
|
2.13
|
0.00
|
1.69
|
0.00
|
0.00
|
0.96
|
0.65
|
0.00
|
1.22
|
1.56
|
1.35
|
0.00
|
0.69
|
0.00
|
0.00
|
0.00
|
1.29
|
0.98
|
0.00
|
1.68
|
1.24
|
0.00
|
0.00
|
0.00
|
0.040
|
|
P
|
2.69
|
1.56
|
1.98
|
2.13
|
1.22
|
1.64
|
0.00
|
0.00
|
2.37
|
2.35
|
1.69
|
0.39
|
1.56
|
1.25
|
0.00
|
0.00
|
0.00
|
0.00
|
2.20
|
0.66
|
2.13
|
1.13
|
1.88
|
1.69
|
Methylation status of the p15 and p21 genes
We examined the methylation status of the p15 gene and p21 gene
promoters in HPP-CFCs, using the MS-PCR technique. Methylated or
unmethylated MS-PCR for p15 yielded PCR products with 207 bp
and 204 bp respectively (figure 4A). For the p21
gene, both methylated and unmethylated MS-PCR products were
133 bp (figure
4B). Of 24 normal controls, 13 (54.2%) tested positive for
p15 methylation, and 9 (37.5%) for p21 methylation. While, of 24
patients evaluated at diagnosis, 5 (20.8%) tested positive for p15
methylation, 3 (12.5%) for p21 methylation. This result
demonstrated that HPP-CFCs of psoriasic patients had lower p15 and
p21 gene methylation, compared with normal controls (χ2
= 5.68, P < 0.05; χ2 = 4.00, P < 0.05).
Discussion
In this study, using an in vitro system, we detected the colony
formation activity of psoriatic BMHC by HPP-CFC colony assay. BMHC
of psoriatic patients showed decreased proliferation capacity.
Furthermore, significantly lower positive frequencies of
methylation of p15 and p21 gene promoters were observed in HPP-CFCs
of psoriatic patients, with higher levels of p15 and p21 gene mRNA
expression.
Psoriasis is a chronic and relapsing inflammatory disease of the
skin associated with various immune abnormalities. Pathogenic T
lymphocytes play a critical role by triggering the chain reaction
of the cellular and molecular networks in the formation of
psoriatic lesions. However, a multitude of recent research results
have revealed that many elements apart from T cells are involved in
the immunopathology of psoriasis, including almost all other blood
cells [4-8]. Once these pathogenic immunocytes become activated,
they will release soluble factors, such as gamma-interferon
(IFN-γ), interleukin-2 (IL-2), IL-8 and tumor necrosis factor-alpha
(TNF-α), to influence the hematopoietic microenvironment, and even
the hematopoietic activity [32, 33].
HPP-CFCs represent an important cell type in hematopoiesis and
provide a model system, particularly in humans, for studying the
properties of primitive progenitor cells in vitro. HPP-CFCs have
been defined by their ability to form large colonies in vitro in
bone marrow cell cultures [34]. The HPP-CFCs have been
characterized by their multi-potential ability to generate
macrophage, granulocyte, megakaryocyte and erythroid lineages [35,
36] and to re-populate the bone marrow of lethally irradiated mice
[37, 38]. Although HPP-CFCs do not fully comprise the stem cell
compartment, because their frequency in the bone marrow is not
predictive of HSC frequency, the HPP-CFCs assay was a preferable
model for investigating the content of HSCs, and their
responsiveness to hematopoiesis growth factors. In this paper, we
found that the colony counts of HPP-CFCs from psoriatic patients’
bone marrow, with decreased proliferation activity, was
significantly lower than that of the normal controls. It implies
that the in vitro activity of psoriatic patients’ HSCs may be
abnormal.
In human cells, cell cycle progression is tightly regulated by a
series of phosphorylation events, which involves Cdks and
Dbf4/ASK-dependent Cdc7 kinase [18-21]. At G1 to S phase
transition, Cdk4/6-cyclin D and Cdk2-cyclin E phosphorylate Rb and
liberate E2F [22-25]. The resulting activation of E2F promotes the
transcription of various cell cycle regulators, including cyclin E1
[39-41], cyclin A2 [42], Cdc2 [43], and Cdc6 [44, 45], an
activation subunit of mammalian Cdc7 kinase. The P15 and P21
proteins all belong to the INK4 kinase family of cyclin-dependent
kinase inhibitors, and they negatively regulate the cell cycle
through competitive inhibition of the cyclin-dependent kinases 2, 4
and 6 involved in Rb-dependent cell cycle regulation.
To explore the molecular mechanisms of the in vitro abnormal
activity of psoriatic patients’ HSC, we detected the mRNA
expression of p15 and p21 genes by semi-quantitative RT-PCR.
Significantly higher mRNA expressions of p15 and p21 genes were
observed in the HPP-CFCs of psoriatic patients. It is suggested
that higher transcriptional levels of p15 and p21 genes are
responsible for the abnormal HPP-CFC colony formation of psoriatic
hematopoietic cells.
The major inactivity mechanism of the p15 and p21 genes is
methylation of the 5′ promoter region of the gene, especially
5′-CpG methylation, which leads to transcription silencing [46,
47]. DNA methylation may directly interfere with the basal
transcriptional machinery by altering the DNA secondary structure,
especially the major groove conformation. DNA methylation can also
induce chromosome remodeling through histone deacetylation,
resulting in transcriptional repression. Aberrant DNA methylation
has been found in p15 and p21 genes, leading to their
down-regulation in tumors [48]. Since then a clear link between CpG
island promoter methylation and gene silencing has been established
through in vitro methylation and transfection studies [49-54]. We
detected the methylation status of cytosines in the CpG islands
present in these promoter regions of p15 and p21 genes in HPP-CFCs,
where the promoter sequences examined are associated with GC-rich
regions and often overlap with the E2F and SP-1 sites. It
demonstrated the significantly lower promoter methylation
frequencies of p15 and p21 in HPP-CFCs from BMHCs of psoriatic
patients, in comparison to normal controls. We guess that the low
methylation of p15 and p21 genes probably has an important role in
the lower proliferation and colony formation of HPP-CFCs, by
up-regulating transcriptional activation of p15 and p21 genes.
Moreover, 5 patients had both p15 and p16 gene methylations in the
HPP-CFCs of patients with psoriasis. Because the p15 and p16 genes
are located in the same locus at 9p21, it suggests that 9p21
is an important loci involved in the pathogenesis of psoriasis.
To our knowledge this is the first report that shows the
dysfunctional HPP-CFC colony formation ability and the promoter
methylation status of p15 and p21 genes of BMHCs in psoriasis. This
might reflect that the proliferate activity of psoriatic HSCs from
bone marrow cells is abnormal and suggest that haematopoietic cells
are involved in pathogenesis of psoriasis. With further studying of
HSCs, and from psoriatic bone marrow haematopoietic cells, we
suppose that psoriasis may be a disease characterized by changes of
skin and blood, as well as cutaneous extra-medullary
hematopoiesis.
Acknowledgments
The authors gratefully acknowledge the support of National Natural
Science Foundation of China and Natural Science Foundation of
Shanxi Province. Conflict of Interest Statement: None declared.
References
1 Schön MP, Boehncke WH. Psoriasis. NEJM 2005; 352:
1899-912.
2 Nickoloff BJ, Nestle FO. Recent insights into the
immunopathogenesis of psoriasis provide new therapeutic
opportunities. J Clin Invest 2004; 113: 1664-75.
3 Gottlieb A. Immunobiologic Agents for the Treatment of
Psoriasis: Clinical Research Delivers New Hope for Patients With
Psoriasis. Arch Dermatol 2003; 139: 791-3.
4 Prinz JC. The role of T cells in psoriasis. J Eur Acad
Dermatol Venereol 2003; 17: 257-70.
5 Asadullah K, Sterry W, Stephanek K, et al.
IL-10 is a key cytokine in psoriasis: proof of principle by IL-10
therapy: a new therapeutic approach. J Clin Invest 2003; 101:
783-94.
6 Ghoreschi K, Thomas P, Breit S, et al.
Interleukin-4 therapy of psoriasis induces Th2 responses and
improves human autoimmune disease. Nat Med 2003; 9: 40-6.
7 Austin LM, Ozawa M, Kikuchi T, et al. The
majority of epidermal T cells in Psoriasis vulgaris lesions can
produce type 1 cytokines, defining TC1 (cytotoxic T lymphocyte) and
TH1 effector populations: a type 1 differentiation bias is also
measured in circulating blood T cells in psoriatic patients. J
Invest Dermatol 1999; 113: 752-9.
8 Li X, Fan X, Zhang K, et al. Influence of
psoriatic peripheral blood CD4+ T and CD8+ T lymphocytes on
C-myc,Bcl-xL and Ki67 gene expression in keratinocytes. Eur J
Dermatol 2007; 15: 147-9.
9 Zarrabeitia MT, Farinas MC,
Rodriguez-Valverde V, et al. T and B cell function in
psoriasis and psoriatic arthropathy. Allergol Immunopathol (Madr)
1989; 17: 155-9.
10 Schon M, Denzer D, Kubitza RC, et al.
Critical role of neutrophils for the generation of psoriasiform
skin lesions in flaky skin mice. J Invest Dermatol 2000; 114:
976-83.
11 Rocha-Pereira P, Santos-Silva A, Rebelo I,
et al. Erythrocyte damage in mild and severe psoriasis. Br J
Dermatol 2004; 150: 232-44.
12 Bloom JC. Principles of hematotoxicology: Laboratory
assessment and interpretation of data. Toxicol Pathol 1993; 21:
130-4.
13 Meuret G, Schmitt E, Hagedorn M.
Monocytopoiesis in chronic eczematous diseaes,psorasis vulgaris,and
mycosis fungoides. J Invest Dermatol 1976; 66: 22-8.
14 Altmeyer P, Munz DL, Chilf G, et al.
Morphological and functional findings of fixed phagocytes in
psoriatics. Arch Dermatol Res 1983; 275: 95-9.
15 Walkley CR, Orkin SH. Rb is dispensable for
self-renewal and multilineage differentiation of adult
hematopoietic stem cells. PNAS 2006; 103: 9057-62.
16 Palis J, Chan RT, Koniski A, et al.
Spatial and temporal emergence of high proliferative potential
hematopoietic precursors during murine embryogenesis. PNAS 2001;
98: 4528-33.
17 Zhang K, Zhang R, Li X, et al. The mRNA
expression and promoter methylation status of the p16 gene in
colony-forming cells with high proliferative potential in patients
with psoriasis. Clin Exp Dermatol 2007; 32: 702-8.
18 Sherr CJ. Mammalian G1 cyclins. Cell 1993; 73:
1059-65.
19 Sherr CJ. G1 phase progression: cycling on cue. Cell
1994; 79: 551-5.
20 Kim JM, Yamada M, Masai H. Functions of
mammalian Cdc7 kinase in initiation/monitoring of DNA replication
and development. Mutat Res 2003; 532: 29-40.
21 Kim JM, Masai H. Genetic dissection of mammalian
Cdc7 kinase: cell cycle and developmental roles. Cell Cycle 2004;
3: 300-4.
22 Maehara K, Yamakoshi K, Ohtani N, et al.
Reduction of total E2F/DP activity induces senescence-like cell
cycle arrest in cancer cells lacking functional pRB and p53. J Cell
Biol 2005: 553-60.
23 Trimarchi JM, Lees JA. Sibling rivalry in the E2F
family. Nat Rev Mol Cell Biol 2002; 3: 11-20.
24 Black E, Hallstrom T, Dressman HK, et al.
Distinctions in the specificity of E2F function revealed by gene
expression signatures. PNAS 2005; 102: 15948-53.
25 Keenan SM, Lents NH, Baldassare JJ. Expression
of Cyclin E Renders Cyclin D-CDK4 Dispensable for Inactivation of
the Retinoblastoma Tumor Suppressor Protein, Activation of E2F, and
G1-S Phase Progression. J Biol Chem 2004; 279: 5387-96.
26 Herman J, Jen J, Merlo A, Baylin S.
Hypermethylation-associated inactivation indicates a tumor
suppressor role for p15INK4B. Cancer Res 1996; 56: 722-7.
27 Quesnel B, Guillerm G, Vereecque R,
et al. Methylation of the p15(INK4b) gene in myelodysplastic
syndromes is frequent and acquired during disease progression.
Blood 1998; 91: 2985-90.
28 Sherr CJ. The Pezcoller lecture: cancer cell cycles
revisited. Cancer Res 2000; 60: 3689-95.
29 Herman JG, Graff JR, Myohanen S, et al.
Methylation-specific PCR: a novel PCR assay for methylation status
of CpG islands. Proc Natl Acad Sci USA 1996; 93: 9821-6.
30 Herman JG. HypermethyLation oftumor suppressor genes in
cancer. Semin Cancer BioL 1999; 9: 359-67.
31 Staalesen V, Leirvaag B, Lillehaug JR. Genetic
and Epigenetic Changes in p21 and p21B Do Not Correlate with
Resistance to Doxorubicin or Mitomycin and 5-Fluorouracil in
Locally Advanced Breast Cancer. Clin Cancer Res 2004; 10:
3438-43.
32 Roussaki SAV, Kouskoukis C, Petinaki E,
et al. Evaluation of cytokine serum levels in patients with
plaque-type psoriasis. Int J Clin Pharmacol Res 2005; 4:
169-73.
33 Austin LM, Ozawa M, Kikuchi T, et al. The
majority of epidermal T cells in Psoriasis vulgaris lesions can
produce type 1 cytokines, defining TC1 (cytotoxic T lymphocyte) and
TH1 effector populations: a type 1 differentiation bias is also
measured in circulating blood T cells in psoriatic patients. J
Invest Dermatol 1999; 113: 752-9.
34 Bradley TR, Hodgson GS. Detection of primitive
macrophage progenitor cells in mouse bone marrow. Blood 1979; 54:
1446-50.
35 Srour EF, Zanjani ED, Cornetta K, et al.
Persistence of human multilineage, self-renewing
lymphohematopoietic stem cells in chimeric sheep. Blood 1993; 82:
3333-42.
36 McNiece IK, Bertoncello I, Kriegler AB,
et al. Colony-forming cells with high proliferative potential
(HPP-CFC). Int J Cell Cloning 1990; 8: 146-60.
37 Ivanovic Z, Bartolozzi B, Bernabei PA,
et al. A Simple, One-Step Clonal Assay Allows the Sequential
Detection of Committed (CFU-GM-like) Progenitors and Several
Subsets of Primitive (HPP-CFC) Murine Progenitors. Stem Cells 1999;
17: 219-25.
38 Liao HF, Chen YJ, Yang YC. A novel
polysaccharide of black soybean promotes myelopoiesis and
reconstitutes bone marrow after 5-flurouracil- and
irradiation-induced myelosuppression. Life Sci 2005; 77:
400-13.
39 Zhang YX, Hamburger AW. Heregulin Regulates the
Ability of the ErbB3-binding Protein Ebp1 to Bind E2F Promoter
Elements and Repress E2F-mediated Transcription. J Biol Chem 2004;
279: 26126-33.
40 Christensen J, Cloos P, Toftegaard U,
et al. Characterization of E2F8, a novel E2F-like cell-cycle
regulated repressor of E2F-activated transcription. Nucleic Acids
Res 2005; 33: 5458-70.
41 Frolov MV, Dyson NJ. Molecular mechanisms of
E2F-dependent activation and pRB-mediated repression. J Cell Sci
2004; 117: 2173-81.
42 White J, Stead E, Faast R, et al. Cell
Cycle-regulated Cyclin-dependent Kinase Activity during Embryonic
Stem Cell Differentiation. Mol Biol Cell 2005; 16: 2018-27.
43 Aleem E, Kiyokawa H, Kaldis P. Cdc2-cyclin E
complexes regulate the G1/S phase transition. Nat Cell Biol 2005;
7: 831-6.
44 Oehlmann M, Score AJ, Blow J. The role of Cdc6
in ensuring complete genome licensing and S phase checkpoint
activation. J Cell Biol 2004; 165: 181-90.
45 Ofir Y, Sagee S, Guttmann-Raviv N, et al.
The Role and Regulation of the preRC Component Cdc6 in the
Initiation of Premeiotic DNA Replication. Mol Biol Cell 2004; 15:
2230-42.
46 Nolan T, Braccini L, Azzalin G, et al.
The post-transcriptional gene silencing machinery functions
independently of DNA methylation to repress a LINE1-like
retrotransposon in Neurospora crassa. Nucleic Acids Res 2005; 33:
1564-73.
47 Jones PA, Takai D. The role of DNA methylation in
mammalian epigenetics. Science 2001; 293: 1068-70.
48 Mund C, Beier V, Bewerunge P, et al.
Array-based analysis of genomic DNA methylation patterns of the
tumour suppressor gene p16INK4A promoter in colon carcinoma cell
lines. Nucleic Acids Res 2005; 33: e73.
49 Waki T, Tamura G, Tsuchiya T, et al.
Promoter Methylation Status of E-Cadherin, hMLH1, and p16 Genes in
Nonneoplastic Gastric Epithelia. Am J Pathol 2002; 161:
399-415.
50 Smet CD, Lurquin C, Lethé B, et al. DNA
Methylation Is the Primary Silencing Mechanism for a Set of Germ
Line- and Tumor-Specific Genes with a CpG-Rich Promoter. Mol Cell
Biol 1999; 19: 7327-35.
51 Pogribny IP, Pogribna M, Christman JK,
et al. Single-Site Methylation within the p53 Promoter Region
Reduces Gene Expression in a Reporter Gene Construct: Possible in
Vivo Relevance during Tumorigenesis. Cancer Res 2000; 60:
588-94.
52 Toyooka S, Toyooka KO, Maruyama R, et al.
DNA Methylation Profiles of Lung Tumors. Mol Cancer Ther 2001; 1:
61-71.
53 Prokhortchouk A, Hendrich B, Jørgensen H,
et al. The p120 catenin partner Kaiso is a DNA
methylation-dependent transcriptional repressor. Genes & Dev
2001; 15: 1613-20.
54 Ruchusatsawat K, Wongpiyabovorn J,
Shuangshoti S, et al. SHP-1 promoter 2 methylation in
normal epithelial tissues and demethylation in psoriasis. J Mol Med
2006; 84: 175-82.
|
Printable version
Version PDF
