ARTICLE
Auteur(s) : Jing Yang1, Yan Li1,
Ye-Qiang Liu1, Jian-Wen Long1, Fen
Tian1, Jing Dong1, Guan-Xin Shen2,
Ya-Ting Tu1, Juan
Tao1
1Department of Dermatology, Affiliated Union
Hospital, Tongji Medical College, Huazhong University
of Science and Technology, Wuhan 430022, China
2Department of Immunology, Tongji Medical College,
Huazhong University of Science and Technology, Wuhan,
China
accepté le 12 Août 2008
Psoriasis is chronic, relapsing, inflammatory and
hyperproliferative skin disease with a high public health impact
[1]. Although altered T-cell activity is certainly involved in
eliciting and maintaining inflammation, recent advances in
molecular medicine have also suggested possible homeostatic defects
in signaling pathways in keratinocytes in psoriasis [2, 3].
Apoptosis has become increasingly recognized as a key mechanism
involved in the maintenance of tissue homeostasis, growth and
development [4]. In normal human skin, keratinocytes in the
superficial layer of the epidermis undergo apoptosis and thereby
regulate or balance the proliferation of cells in the basal cell
layer [5, 6]. Apoptotic keratinocytes also result in the formation
of the stratum corneum [7]. The epidermal hyperplasia
characteristic of psoriasis has been implicated to be a result of
epidermal expression of apoptosis-related molecules leading to
suppression of the apoptotic process [8].
A key inhibitor of death receptor signaling is c-FLIP (cellular
FLICE inhibitory protein), which interacts with FADD and
procaspase-8, preventing it from binding to caspase-8, thereby
inhibiting the initiation of the apoptosis cascade [9, 10]. At same
time, the c-FLIP also mediates growth signals by activating NF-κB
and ERK pathway in some cases [11].
Overexpression of the anti-apoptotic protein, c-FLIP, in T cells
and tumor cells correlates with autoimmunity and tumor in mice and
humans, and with resistance to FAS ligand (FAS-L)-mediated cell
death [12-14].
In psoriasis, the reasons for the higher proliferating activity
and the disturbance in differentiation of keratinocytes are not yet
understood. Until now, no studies on the expression of c-FLIP in
psoriasis have been reported yet. In the present study, we
investigated the expression pattern of anti-apoptosis molecules,
c-FLIP, by using real time quantitative RT-PCR and
immunohistochemical analyses, and analyzed the association between
its expression, proliferation and apoptosis in psoriasis.
Materials and methods
Patients and specimens
Thirty adult patients (older than 18) of both sexes diagnosed with
psoriasis at the Department of Dermatology, Affiliated Union
Hospital, Tongji Medical College, Huazhong University of Science
and Technology were enrolled in the study between 2005 and 2007.
Psoriasis was diagnosed by typical clinical features and histology.
Patients who had undergone PUVA or received oral therapy up to 4
weeks before biopsy and used topical medications up to 2 weeks
before biopsy were excluded. Before treatment the severity of the
psoriasis was evaluated using the PASI score (Psoriasis Area and
Severity Index) according to Fredriksson & Pettersson [15], and
the local skin region was scored on a scale of 0-4 for erythema,
induration and desquamation (to give summed scores from 0 to a
maximum of 12) according to Smith et al. [16]. In the patients
studied, the PASI scores ranged from 5.80 to 29.70 (mean 12.56 ±
5.89); the target plaque scores ranged from 2 to 10 (mean 5.73 ±
2.15).
Biopsy samples of involved and uninvolved psoriatic skin were
taken from patients. Uninvolved skin specimens were taken at least
1 cm away from the psoriatic lesion. Twenty samples of normal
skin from healthy donors surrounding fibromas or hemangiomas,
surgically resected for cosmetic reasons, served as a control
group. Informed consent was obtained from all patients before the
biopsy. The median age of psoriatic patients was 40.1 (28.0-69.0)
years and 35.5 (14.0-63.0) years for healthy controls. There was no
significant difference in sex and age between the groups of
patients and controls (P = 0.87 and 1.000). All specimens were
fixed in 10% buffered formaldehyde and embedded in paraffin.
Specimen sections, 4 μm thick, were stained with
hematoxylin-eosin, and two different pathologists examined each
slide independently.
Immunohistochemical staining
Monoclonal and polyclonal antibodies
Monoclonal mouse anti-human c-FLIP (clone NF6; Alexis, Lausen,
Switzerland) and a mouse monoclonal anti-human PCNA antibodies
(F-2, sc-25280, Santa Cruz Biotechnology) were used. Streptavidin
peroxidase (SP) kit was purchased from Santa Cruz Biotechnology,
USA.
Immunohistochemistry
Tissue specimens were fixed in 10% formalin, embedded in paraffin
and cut into consecutive sections of 5 μm thickness. The
sections were treated with 0.3% hydrogen peroxide to block
endogenous peroxidase activity. Following incubation with normal
goat serum for 20 min, the sections were incubated for
4 h at room temperature with primary antibodies. And then the
slides were incubated with biotin-conjugated secondary antibodies
for 30 min. The streptavidin-peroxidase complex was added for
30 min. The colour reaction was developed with
diaminobenzidine. Sections were finally counterstained with Mayer
hematoxylin and mounted in glycerol gelatin. The staining of
negative control sections was performed by replacing the primary
antibody with PBS. Coded slides were analyzed using a
semiquantitative scoring method (0-4) which has been previously
validated in similar studies of immunohistochemistry (0, no
staining; 1, < 25%; 2, 25-50%; 3, 50-75%; 4 > 75% staining).
Detection of apoptosis by TUNEL
For detection of apoptotic cells, sections from lesional biopsies
of patients and the normal group were stained by TUNEL technique
using an in-situ apoptosis detection kit, AP (Roche, CH) according
to the supplier’s instructions. The apoptotic index was calculated
according to Kikuchi & Nishikawa [17] as follows: Apoptotic
index (%) = (n, TUNEL+ ve cells/total 10,000 cells counted) ×100.
SYBR Green real time RT-PCR assay
Total RNA from the epidermis was extracted using the TRIzol reagent
(Invitrogen). The purity and concentration of total RNA were
detected by an ultraviolet spectrophotometer. 2 μL total RNA
was reversely transcribed and synthesized to complementary DNA
(cDNA) in 20 μL reaction system using reverse transcriptase
(Promega). Equal amounts of cDNA were submitted to PCR, in the
presence of SYBR green dye with the QuantiTect SYBR Green RT-PCR
Kit (QIAGEN) and the ABI PRISM 6700 Real time PCR detection machine
(Fengling Biotechnology Inc.). c-FLIP and the housekeeping gene,
GAPDH, were amplified using the primers as follows. Each sample was
normalized by using the difference in critical thresholds (CT)
between target gene and GAPDH. The following equation was used to
describe the result: Δ Δ CT target gene= Δ CT target gene at
indicated time -Δ CT target gene at 0h where Δ CT target gene was
the difference in CT between target gene and GAPDH, and Δ CT target
gene at 0h was the difference between target gene and GAPDH at 0h.
The mRNA levels of each sample were then compared using the
expression 2- Δ Δ CT target gene. The results of each
group were averaged.
c-FLIP: 5’- ATTGGTGAGGATTTGGATAA -3’ (sense primer)
5’-TGGGCGTTTTCTTTCTTGTC-3’ (antisense primer)
GAPDH: 5’-GTCAACGGATTTGGTCGTATTG-3’ (sense primer)
5’-TGGAGGGATCTCGCTCCTGGAAGAT-3’ (antisense primer)
Statistical analysis
Data analysis was performed using the SPSS 11.0 Statistical
Software. The statistical significance of the difference in the
levels of c-FLIP between the lesional and the non-lesional samples
of psoriasis patients was assessed using the Mann-Whitney
nonparametric tests. Correlations between c-FLIP, PCNA, AI and the
PASI scores were determined using the Bivariate correlations
analysis. p < 0.05 was considered statistically significant.
Results
The protein expressions of c-FLIP and PCNA
in normal, lesional and non-lesional psoriatic skin
The expression and localization of c-FLIP and PCNA in normal,
nonlesional and lesional psoriatic skin were determined by
immunohistochemical analyses (figure 1). In normal and
non-lesional psoriatic skin, PCNA exhibited a clear nuclear
localization in the basal layer of the epidermis (figures 1A and B), whereas
many PCNA-positive nuclei were seen in the keratinocytes of all
epidermal layers in the lesional psoriatic skin (figure 1C). c-FLIP was
strongly expressed in cytoplasms of keratinocytes within all
epidermal layers in lesional psoriatic skin, especially in the
granular and spinous layers (figure 1D), whereas weak
c-FLIP staining was restricted to the basal and suprabasal layers
of the epidermis in non-lesional psoriatic and normal skin (figures 1E and F).
c-FLIP expression was significantly higher in lesional vs. normal
and non-lesional skin (P < 0.01, for both). The eccrine sweat
glands, hair follicles and sebaceous glands showed a weak
expression of c-FLIP in normal and psoriatic skin.
Apoptosis in psoriatic and normal skin
The apoptotic index was evaluated in psoriatic biopsies and normal
skins (table 1). There were few
apoptotic keratinocytes or lymphocytes detected in lesional
psoriatic skin (figure
2A) However, apoptotic keratinocytes and lymphocytes were
observed in normal and non-lesional psoriatic skin. And apoptosis
was more noticeable in keratinocytes than in lymphocytes in normal
skin and non-lesional psoriatic skin (figure 2B and C).
Table 1 Apoptotic index in psoriatic and normal skin
|
|
Number
|
AI%
|
|
Psoriasis skin
|
Differentiated
|
30
|
8.5±1.16
|
|
Germinative
|
30
|
5.2±1.78
|
|
Uninvolved psoriatic skin
|
Differentiated
|
30
|
30.9±3.69
|
|
Germinative
|
30
|
19.7±3.95
|
|
Normal skin
|
Differentiated
|
20
|
31.2±2.57
|
|
Germinative
|
20
|
18.5±2.53
|
Correlation between c-FLIP, PASI score, local target region
score, PCNA and AI
Although the absolute level of c-FLIP expression varied from
patient to patient, its expression in lesional epidermis was
significantly higher (p < 0.05) than that in non-lesional
epidermis and normal skin. When the PASI score and local target
region score were applied, there was a significant positive
correlation between c-FLIP expression in the lesional epidermis and
the PASI score, target region score (Spearman’s rho = 0.83, rho =
0.80 p < 0.05). And there was a similar correlation between
c-FLIP expression and PCNA (Spearman’s rho = 0.61, p < 0.05).
However there was a negative correlation between c-FLIP expression
and AI (Spearman’s rho = – 0.41, p < 0.05).
The mRNA expression of cFLIP in lesional,
non-lesional psoriatic skin and normal skin
c-FLIP mRNA expression was detected in all clinically involved
psoriasis biopsies by real time RT-PCR. Although inter-individidual
differences in c-FLIP mRNA expression were observed, the level of
c-FLIP mRNA expression in lesional psoriatic skin was higher
compared with non-lesional psoriatic skin and normal skin.
Furthermore, the elevation of the mean c-FLIP mRNA expression in
lesional psoriatic skin compared with non-lesional psoriatic skin,
normal skin was statistically significant (figure 3; 3.8-fold;
3.6-fold, P < 0.01, Mean ± SEM).
Discussion
Upregulation of cell survival pathways and suppression of apoptosis
are implicated in the development of psoriasis. In previous
reports, the anti-apoptotic molecules, primarily of the Bcl-2
family [8] and survivin [18] were high expressed in psoriasis. The
Bcl-2 family, such as Bcl-2, Bcl-xL could interact with Bax and
then inhibit the apoptotic effect of Bax [19, 20]. Survivin is the
member of the inhibitor of apoptosis family which is upregulated
during the G2M phase of cellcycle and is known as a regulator of
mitosis [21].
Recently, c-FLIP has been identified as an inhibitor of
apoptosis triggered by engagement of death receptors such as Fas or
TRAIL (TNF-related apoptosis-inducing ligand) [9, 10].
Dysregulation of c-FLIP expression has been shown to be associated
with various diseases, such as cancer and autoimmune diseases
[12-14]. Because little is known about c-FLIP expression with
respect to psoriasis, we analyzed c-FLIP expression
immunohistochemically in biopsies of normal and psoriatic skin.
This study showed that the level of c-FLIP was significantly
increased in lesional psoriatic epidermis compared with normal and
non-lesional psoriatic epidermis. And its localization was within
all the epidermal layers in lesional psoriatic skin, especially in
the granular and spinous layers, whereas weak c-FLIP staining was
restricted to the basal and suprabasal layers of the epidermis in
normal and non-lesional psoriatic skin. As the level of c-FLIP
increases, caspase-8 activation is inhibited, eventually leading to
inhibition of cell apoptosis and an increase of cell proliferation
[10]. c-FLIP was upregulated to levels sufficient to prevent death
receptor-induced apoptosis in many human tumor cells, including
colorectal cancer [22], melanoma [23], and ovarian carcinoma [24].
Therefore our results implicate c-FLIP expression as an important
mechanism protecting keratinocytes from apoptotic elimination. In
this regard, it has been reported that decreased c-FLIP levels
enhance the sensitivity of tumor cells not only to Fas but also to
TNF-related apoptosis induced ligand (TRAIL)-mediated apoptosis
[25]. These data render c-FLIP an attractive candidate to predict
the effectiveness of future immune therapies in colon cancer [26].
Therefore c-FLIP might be a potential new target for preventing
keratinocyte proliferation in psoriasis in the future.
To determine the role of increased c-FLIP on the severity of
psoriasis, we evaluated the relationship between the PASI score,
the target region score and c-FLIP protein. The correlation between
c-FLIP expression in lesional epidermis and the PASI scores showed
a significant positive correlation. This result indicated that
increased levels of c-FLIP in psoriatic skin were highly related to
the clinical severity of psoriasis. We also observed increased
levels of c-FLIP expression in lesional epidermis with psoriasis,
together with increased levels of PCNA, but with decreased levels
of AI. This suggested that the increased levels of c-FLIP might
induce upregulation of keratinocyte proliferation and
downregulation of the apoptotic signaling pathway in psoriatic
epidermis. Several lines of evidence strengthen this finding.
c-FLIP has recently been shown to be an important mediator of
nuclear factor-κB and pI3/Akt-controlled anti-apoptotic signals in
cells [11]. c-FLIP is associated with the generation of positive
signals for cell proliferation by activation of the ERK pathway
through Raf-1 binding [11]. These results further indicate that
c-FLIP might contribute to keratinocyte hyperproliferation in
psoriasis. Several antipsoriatic agents also inhibit keratinocyte
proliferation and increase keratinocyte apoptosis. These include
propylthiouracil [27], steroids [28], methotrexate [29],
cyclosporine A [30] and calcipotriol [28]. Further
investigation is required to identify whether c-FLIP takes part in
promoting the keratinocyte apoptosis induced by these antipsoriatic
agents in psoriasis.
Quantitative RT-PCR analysis was performed to investigate
whether the increased c-FLIP protein level was paralleled by an
increased accumulation of the corresponding mRNA in psoriatic skin.
The expression of c-FLIP was dramatically upregulated at the mRNA
as well as at the protein level in hyperproliferative lesional skin
from psoriasis patients. Significant differences in c-FLIP mRNA
expression were observed in lesional psoriatic epidermis compared
with normal and non-lesional psoriatic epidermis, demonstrating a
transcriptional regulation of c-FLIP expression in psoriatic skin.
The mechanism of c-FLIP transcriptional regulation in psoriasis
will be further studied in the future.
Conclusion
In conclusion, we have shown that increased c-FLIP expression in
psoriatic skin is closely related to the clinical severity of
psoriasis and has a positive correlation with keratinocyte
proliferation and a negative correlation with keratinocyte
apoptosis in psoriasis. These results suggest that anti-apoptotic
c-FLIP protein may play a prominent role in psoriasis epidermal
hyperplasia.
Acknowledgements
Financial support: none. Conflict of interest: none.
References
1 Barker J. Skin diseases with high public health impact.
Psoriasis. Eur J Dermatol 2007; 17: 563-4.
2 Karvonen SL, Korkiamaki T, Yla-Outinen H,
et al. Psoriasis and altered calcium metabolism: downregulated
capacitative calcium influx and defective calcium-mediated cell
signaling in cultured psoriatic keratinocytes. J Invest Dermatol
2000; 114: 693-700.
3 Elder JT, Nair RP, Voorhees JJ. Epidemiology
and the genetics of psoriasis. J Invest Dermatol 1994; 102:
24S-27S.
4 Raskin CA. Apoptosis and cutaneous biology. J Am Acad
Dermatol 1997; 36: 885-96; (quiz 97-8).
5 Polakowska RR, Piacentini M, Bartlett R,
et al. Apoptosis in human skin development: morphogenesis,
periderm, and stem cells. Dev Dyn 1994; 199: 176-88.
6 Weil M, Raff MC, Braga VM. Caspase activation
in the terminal differentiation of human epidermal keratinocytes.
Curr Biol 1999; 9: 361-4.
7 Ishida-Yamamoto A, Tanaka H, Nakane H,
et al. Programmed cell death in normal epidermis and loricrin
keratoderma. Multiple functions of profilaggrin in keratinization.
J Investig Dermatol Symp Proc 1999; 4: 145-9.
8 Takahashi H, Manabe A, Ishida-Yamamoto A,
et al. Aberrant expression of apoptosis-related molecules in
psoriatic epidermis. J Dermatol Sci 2002; 28: 187-97.
9 Krueger A, Baumann S, Krammer PH, et al.
FLICE-inhibitory proteins: regulators of death receptor-mediated
apoptosis. Mol Cell Biol 2001; 21: 8247-54.
10 Thome M, Tschopp J. Regulation of lymphocyte
proliferation and death by FLIP. Nat Rev Immunol 2001; 1: 50-8.
11 Kataoka T, Budd RC, Holler N, et al. The
caspase-8 inhibitor FLIP promotes activation of NF-kappaB and Erk
signaling pathways. Curr Biol 2000; 10: 640-8.
12 Xu L, Zhang L, Yi Y, et al. Human lupus T
cells resist inactivation and escape death by upregulating COX-2.
Nat Med 2004; 10: 411-5.
13 van Houdt IS, Muris JJ, Hesselink AT,
et al. Expression of c-FLIP is primarily detected in diffuse
large B-cell lymphoma and Hodgkin’s lymphoma and correlates with
lack of caspase 8 activation. Histopathology 2007; 51: 778-84.
14 Mathas S, Lietz A, Anagnostopoulos I,
et al. c-FLIP mediates resistance of Hodgkin/Reed-Sternberg
cells to death receptor-induced apoptosis. J Exp Med 2004; 199:
1041-52.
15 Fredriksson T, Pettersson U. Severe psoriasis--oral
therapy with a new retinoid. Dermatologica 1978; 157: 238-44.
16 Smith CH, Jackson K, Chinn S, et al. A
double blind, randomized, controlled clinical trial to assess the
efficacy of a new coal tar preparation (Exorex) in the treatment of
chronic, plaque type psoriasis. Clin Exp Dermatol 2000; 25:
580-3.
17 Kikuchi A, Nishikawa T. Apoptotic and proliferating
cells in cutaneous lymphoproliferative diseases. Arch Dermatol
1997; 133: 829-33.
18 Bowen AR, Hanks AN, Murphy KJ, et al.
Proliferation, apoptosis, and survivin expression in keratinocytic
neoplasms and hyperplasias. Am J Dermatopathol 2004; 26:
177-81.
19 Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2
heterodimerizes in vivo with a conserved homolog, Bax, that
accelerates programmed cell death. Cell 1993; 74: 609-19.
20 Adams JM, Cory S. The Bcl-2 protein family:
arbiters of cell survival. Science 1998; 281: 1322-6.
21 Li F, Ambrosini G, Chu EY, et al. Control
of apoptosis and mitotic spindle checkpoint by survivin. Nature
1998; 396: 580-4.
22 Wilson TR, McLaughlin KM, McEwan M,
et al. c-FLIP: a key regulator of colorectal cancer cell
death. Cancer Res 2007; 67: 5754-62.
23 Irmler M, Thome M, Hahne M, et al.
Inhibition of death receptor signals by cellular FLIP. Nature 1997;
388: 190-5.
24 Abedini MR, Qiu Q, Yan X, et al. Possible
role of FLICE-like inhibitory protein (FLIP) in chemoresistant
ovarian cancer cells in vitro. Oncogene 2004; 23: 6997-7004.
25 Wang Q, Wang X, Zhou Y, et al.
PKCdelta-mediated regulation of FLIP expression in human colon
cancer cells. Int J Cancer 2006; 118: 326-34.
26 Galligan L, Longley DB, McEwan M, et al.
Chemotherapy and TRAIL-mediated colon cancer cell death: the roles
of p53, TRAIL receptors, and c-FLIP. Mol Cancer Ther 2005; 4:
2026-36.
27 Elias AN, Barr RJ. Enhanced apoptosis in psoriatic
plaques after treatment with propylthiouracil. Eur J Dermatol 2007;
17: 353-4.
28 Adisen E, Gulekon A, Erdem O, et al. The
effects of calcipotriol and methylprednisolone aseponate on bcl-2,
p53 and ki-67 expression in psoriasis. J Eur Acad Dermatol Venereol
2006; 20: 527-33.
29 Heenen M, Laporte M, Noel JC, et al.
Methotrexate induces apoptotic cell death in human keratinocytes.
Arch Dermatol Res 1998; 290: 240-5.
30 Sugie N, Fujii N, Danno K. Cyclosporin-A
suppresses p53-dependent repair DNA synthesis and apoptosis
following ultraviolet-B irradiation. Photodermatol Photoimmunol
Photomed 2002; 18: 163-8.
|
Printable version
Version PDF
