Home > Journals > Medicine > European Journal of Dermatology > Full text
 
      Advanced search    Shopping cart    French version 
 
Latest books
Catalogue/Search
Collections
All journals
Medicine
European Journal of Dermatology
- Current issue
- Archives
- Subscribe
- Order an issue
- More information
Biology and research
Public health
Agronomy and biotech.
My account
Forgotten password?
Online account   activation
Subscribe
Licences IP
- Instructions for use
- Estimate request form
- Licence agreement
Order an issue
Pay-per-view articles
Newsletters
How can I publish?
Journals
Books
Help for advertisers
Foreign rights
Book sales agents



 

Texte intégral de l'article
 
  Printable version
  Version PDF

Changing expression of the genes related to human hair graying


European Journal of Dermatology. Volume 18, Number 4, 397-9, July-August 2008, Genes and skin

DOI : 10.1684/ejd.2008.0434

Summary  

Author(s) : Young Jin Choi, Tae Jin Yoon, Young Ho Lee , Department of Anatomy, College of Medicine, Chungnam National University, 6 Moonwha-dong, Jung-gu, Daejeon 301-131, Korea, Department of Dermatology, School of Medicine, Gyeongsang National University, 90 Chilam-dong, Jinju 660-702, Korea.

Summary : Hair graying is one of the prototypical signs of human aging, but its mechanism is largely unknown. To elucidate the mechanism of hair graying, we investigated gene expression related to melanogenesis in human hair. The key molecules in melanogenesis, microphthalmia-associated transcription factor-M (MITF-M), Sox10, Pax3, tyrosine related protein-1 (TRP-1), and tyrosinase, were absent or greatly reduced in the bulbs of white hair compared to black hair. Melanocyte stem cells (MSCs) or melanocytes express markers for neural crest cells, Sox10, Pax3, and MITF-M. Taken together, our data suggest that hair graying is caused by defective migration of MSCs into the bulb area of hair.

Keywords : genes, hair graying, melanocytes, melanocyte stem cells, microphthalmia transcription factor

Pictures

ARTICLE

Auteur(s) : Young Jin Choi1, Tae Jin Yoon2, Young Ho Lee1

1Department of Anatomy, College of Medicine, Chungnam National University, 6 Moonwha-dong, Jung-gu, Daejeon 301-131, Korea
2Department of Dermatology, School of Medicine, Gyeongsang National University, 90 Chilam-dong, Jinju 660-702, Korea

accepté le 27 Mars 2008

Hair graying is one of the prototypical signs of human aging, and the maintenance of hair pigmentation is dependent on the presence and functionality of melanocytes, which are derived from neural crest cells and synthesize pigment for growing hair [1-3]. The mechanism of hair graying, however, has remained unclear.

Hair graying results from a reduction in tyrosinase activity of hair bulbar melanocytes due to the cytotoxic oxidative nature of melanin biosynthesis, suboptimal melanocyte-cortical keratinocyte interactions, and defective migration of melanocytes from a reservoir in the upper outer root sheath to the pigment-permitting microenvironment close to the dermal papilla of the hair bulb [4, 5]. Recently, Nishimura et al. [6] demonstrated that hair graying is caused by defective self-maintenance of melanocyte stem cells (MSCs). This process is accelerated dramatically with Bcl2 deficiency, which causes the selective apoptosis of MSCs but not differentiated melanocytes within the niche at their entry into the dormant state. The physiological aging of MSCs is associated with ectopic pigmentation or differentiation within the niche, a process accelerated by mutation of the melanocyte master transcriptional regulator, microphthalmia transcription factor (MITF).

Melanocytes are derived from the neural crest and differentiate under the control of MITF, a basic helix-loop-helix leucine zipper transcription factor that activates genes involved in pigment production (e.g., dopachrome tautomerase (Dct), tyrosinase (Tyr), and tyrosine related protein-1 (TRP-1)) and melanocyte survival (e.g., Bcl2) [7-9]. MITF consists of at least six isoforms, called MITF-M, MITF-A, MITF-B, MITF-C, MITF-H, and MITF-J [10, 11].

Pax3 activates the expression of MITF, a transcription factor critical for melanogenesis, while it simultaneously competes with MITF for occupancy of an enhancer required for the expression of Dct, an enzyme that functions in melanin synthesis [12, 13].

Sox10 binds to the MITF promoter directly and activates transcription. The ability of Sox10 to activate transcription of the MITF promoter implicates Sox10 in the regulation of melanocyte development and provides a molecular basis for hypopigmentation [14, 15].

In this study, we further elucidated the mechanism of hair graying by investigating the gene expression related to melanogenesis in human hair.

Materials and methods

Materials

Black and white hairs were plucked from six fresh cadavers (32-58 years of age, mean 46.6 years) donated for medical research and education at the Department of Anatomy, College of Medicine, Chungnam National University in Korea. The hair bulbs were obtained from these hairs.

RT-PCR

Total RNA was isolated from the black and white hairs using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Approximately 10 μg of total RNA from the hairs was used to generate cDNA in a 40-μL reaction using 200 units of SuperScript II (Invitrogen) reverse transcriptase and an oligo dT primer. Subsequently, 2 μL of the cDNA was used to analyze the presence of common MITF, Tyr, TRP-1, TRP-2, Pax3, and Sox10 using PCR amplification. The 5′ and 3′ primers for each gene are listed in table 1. In addition, 2 μL of the cDNA was used to analyze the presence of each isoform using PCR amplification with isoform-specific 5′ primers for MITF together with a common 3′ primer [Supplementary table 1 in Reference No. 10]. As a control for cDNA levels, primers for GAPDH were used.
Table 1 PCR primers for common MITF, Tyr, Pax3, Sox10, TRP-1, and TRP-2

Gene

Primer sequence

Common MITF

5’-Primer CCCGGTGCAGAATTCTAACT

3’-Primer AAGCATCCGCAAGAGACAGT

Tyr

5’-Primer AGGCAGAGGTTCCTGTCAGA

3’-Primer CTATGCCAAGGCAGAAAAGC

Pax3

5’-Primer AGCACCCCAATCAGATGAAG

3’-Primer TGTCTGGGTTGGAAGGAATC

Sox10

5’-Primer GCCAGATCAAAGGTCTCCAT

3’-Primer TGCAGCACAAGAAAGACCAC

TRP-1

5’-Primer CTCCTGCACACCTTCACAGA

3’-Primer TCAGTGAGGAGAGGCTGGTT

TRP-2

5’-Primer TCCCAATCCTGAAAGTCACC

3’-Primer GCCAGGTAACAAATGCAGGT

Results

mRNA for Tyr, MITF, TRP-1, and TRP-2, which are related to melanogenesis, was expressed in black hair. The expression of the Tyr, TRP-1, and TRP-2 genes decreased markedly (or was nearly absent) in white hair compared to black hair. In contrast, exon 9 common to the MITF genes was expressed moderately in white hair, albeit at levels lower than in black hair (figure 1). That is, expression of the Tyr and TRP-1 genes decreased markedly in white hair compared to black hair, while, unexpectedly, MITF gene expression did not decrease notably in white hair compared to black hair.

Then, we performed RT-PCR for MITF isoforms with isoform-specific primers. In addition to MITF-M, the MITF-A, -C, -D, -H, and -J genes were expressed highly in black hair, while MITF-B and -E were expressed weakly compared to the other isoforms. In contrast, MITF-M was not expressed in white hair, while the other MITF isoforms were expressed similarly in both white and black hairs (figure 2).

We measured the expression of the Pax3 and Sox10 genes, which are key transcriptional factors of MITF-M, in black and white hairs and found that the MITF-M, Pax3, and Sox10 genes were expressed in black hair, but not in white hair (figure 3).

Discussion

Our findings indicated that expression of the key molecules in melanogenesis, MITF-M, Sox10, Pax3, TRP-1, and Tyr, were absent or greatly reduced in the bulbs of white hair compared to black hair.

Of the MITF isoforms (MITF-A, -J, -C, -Mc, -E, -H, -D, -B, and -M), only the MITF-M isoform was previously reported to be expressed in hair [11, 16]. MITF-D is expressed in the retinal pigment epithelium, and is involved in melanogenesis controlling Tyr expression. However, we also found that MITF-A, -C, -H, and -J were expressed highly in black and white hairs compared to the other MITF isoforms, while MITF-D was not detected. Interestingly, MITF-M was highly expressed in black hair, but was not detected in white hair. Exon 9, which is common to MITF, was moderately expressed in white hair compared to the molecules involved in melanogenesis: Tyr and TRP-1. These data show that various MITF isoforms are expressed in human hair. The switching-off of MITF-M expression in the white hair bulb was a novel finding and is an important clue for elucidating the mechanism of hair graying.

MITF-M is expressed in melanocytes in the hair bulb and in the MSCs in the bulge area of hair [6, 13]. MSCs in the hair bulge migrate into the hair bulb and become melanocytes. Our finding that MITF-M expression is absent in the bulb area of white hair provides two possible explanations for hair graying. First, MSCs from the bulge area migrate into the bulb area, but cannot produce MITF-M and other molecules related to melanogenesis; i.e., they become amelanogenic melanocytes. Alternatively, MSCs do not migrate into the bulb area from the bulge area, and so melanocytes are not present in the bulb area of white hair. In this study, Sox10, Pax3, and MITF-M were not detected in the hair bulbs of white hair. MSCs or melanocytes express markers for neural crest cells, i.e., Sox10 and Pax3 [12, 14, 15]. Therefore, our results suggest that MSCs in the bulge area do not migrate into the bulb area of white hair.

In conclusion, our study provides data supporting the recently proposed mechanism of hair graying: hair graying is caused by defective migration of MSCs into the bulb area of hair.

Acknowledgement

This study was supported by Chungnam National University Research Fund 2005. Conflict of interest: none.

References

1 Sarin KY, Artandi SE. Aging, graying and loss of melanocyte stem cells. Stem Cell Rev 2007; 3: 212-7.

2 Lin JY, Fisher DE. Melanocyte biology and skin pigmentation. Nature 2007; 445: 843-50.

3 Kerscher M, Williams S, Dubertret L. Cosmetic dermatology and skin care. Eur J Dermatol 2007; 17: 180-2.

4 Tobin DJ, Paus R. Graying: gerontobiology of the hair follicle pigmentary unit. Exp Gerontol 2001; 36: 29-54.

5 Van Neste D, Tobin DJ. Hair cycle and hair pigmentation: dynamic interactions and changes associated with aging. Micron 2004; 35: 193-200.

6 Nishimura EK, Granter SR, Fisher DE. Mechanisms of hair graying: incomplete melanocyte stem cell maintenance in the niche. Science 2005; 307: 720-4.

7 Steingrímsson E, Copeland NG, Jenkins NA. Melanocytes and the microphthalmia transcription factor network. Annu Rev Genet 2004; 38: 365-411.

8 McGill GG, Horstmann M, Widlund HR, Du J, Motyckova G, Nishimura EK, Lin YL, Ramaswamy S, Avery W, Ding HF, Jordan SA, Jackson IJ, Korsmeyer SJ, Golub TR, Fisher DE. Bcl2 regulation by the melanocyte master regulator Mitf modulates lineage survival and melanoma cell viability. Cell 2002; 109: 707-18.

9 Widlund HR, Fisher DE. Microphthalamia-associated transcription factor: a critical regulator of pigment cell development and survival. Oncogene 2003; 22: 3035-41.

10 Takeda K, Yasumoto K, Kawaguchi N, Udono T, Watanabe K, Saito H, Takahashi K, Noda M, Shibahara S. Mitf-D, a newly identified isoform, expressed in the retinal pigment epithelium and monocyte-lineage cells affected by Mitf mutations. Biochim Biophys Acta 2002; 1574: 15-23.

11 Hershey CL, Fisher DE. Genomic analysis of the Microphthalmia locus and identification of the MITF-J/Mitf-J isoform. Gene 2005; 347: 73-82.

12 Lang D, Lu MM, Huang L, Engleka KA, Zhang M, Chu EY, Lipner S, Skoultchi A, Millar SE, Epstein JA. Pax3 functions at a nodal point in melanocyte stem cell differentiation. Nature 2005; 433: 884-7.

13 Steingrímsson E, Copeland NG, Jenkins NA. Melanocyte stem cell maintenance and hair graying. Cell 2005; 121: 9-12.

14 Wong CE, Paratore C, Dours-Zimmermann MT, Rochat A, Pietri T, Suter U, Zimmermann DR, Dufour S, Thiery JP, Meijer D, Beermann F, Barrandon Y, Sommer L. Neural crest-derived cells with stem cell features can be traced back to multiple lineages in the adult skin. J Cell Biol 2006; 175: 1005-15.

15 Lee M, Goodall J, Verastegui C, Ballotti R, Goding CR. Direct regulation of the Microphthalmia promoter by Sox10 links Waardenburg-Shah syndrome (WS4)-associated hypopigmentation and deafness to WS2. J Biol Chem 2000; 275: 37978-83.

16 Tachibana M. MITF: a stream flowing for pigment cells. Pigment Cell Res 2000; 13: 230-40.


 

About us - Contact us - Conditions of use - Secure payment
Latest news - Conferences
Copyright © 2007 John Libbey Eurotext - All rights reserved
[ Legal information - Powered by Dolomède ]