ARTICLE
Auteur(s) : Juliette Sok, Nathalie Pineau, Maria
Dalko-Csiba, Lionel Breton, Françoise Bernerd
L’Oréal Recherche, Centre de Recherche C Zviak, 90 rue du
Général Roguet, 92583 Clichy Cedex, France
accepté le 15 Janvier 2008
As a result of improved life expectancy, the proportion of
people over 55 has been continuously increasing, which has raised
growing needs to reduce visible signs of aging [1]. Skin aging is
characterized by wrinkle formation and the sagging associated with
a decrease in dermal density and strength. Ultrasound studies have
given evidence of alterations in the superficial dermis in aged
skin, reflecting a decreased density [2, 3]. From a biological
point of view, significant histological changes occur within the
dermis accompagnied by an increased degradation of extracellular
matrix (ECM) through up-regulation of MMP production as well as a
decrease in collagen content and synthesis [4-6]. Structural
modifications of the superficial dermis during the aging process
have to be paralleled with considerable alterations of dermal
epidermal junction (DEJ). One of the major morphological features
of aged skin is a flattening of DEJ outline with the loss of rete
pegs and re-duplication of the lamina densa [7]. From that point of
view DEJ changes are considered as crucial markers of skin aging
[8]. At the structural level, DEJ consists of four distinct stacked
zones including, from epidermis to dermis: 1) plasma membrane and
hemidesmosomes belonging to basal keratinocytes, 2) lamina lucida
containing laminin 5, 3) lamina densa mostly consisting of type IV
collagen, perlecan and nidogen, and 4) a sublamina fibrillar zone
containing anchoring fibrils of type VII collagen [9, 10]. A
preferential accumulation of several ECM proteins such as fibers of
pro-collagens type I and III, and microfibrils of fibrillin 1 is
observed in this upper part of the papillary dermis. Several of
these components have been shown to be altered and reduced in aged
skin. Collagen VII, which is responsible for anchoring the basement
membrane onto dermal matrix, decreases with aging [11]. This
reduction has been shown to represent an important biochemical
marker of wrinkles [12]. During aging, the papillary dermis tends
to be reduced which could be related to decreased expression of
procollagen 1 [4, 13] and fibrillin 1 [14]. Since the DEJ is
involved in the cohesion between the dermis and epidermis but also
provides a dynamic interface for the regulation of soluble factor
exchanges between the two compartments [15, 16], age-related
alterations entail functional changes in skin resistance to
mechanical stress [17] and tissue homeostasis [18-20].
Previous data from our laboratory showed that the use of a human
complete reconstructed skin in vitro allowed de novo morphogenesis
of the dermal epidermal junction to be investigated [21].
Respective participation and interactions of both cell types could
be assessed in a kinetic view. In addition, the model allowed the
beneficial effects of products on DEJ formation to be assessed
[22]. A new xylopyranoside derivative (C-Xyloside,
Pro-xylaneTM) was recently developed and shown to induce
biological activity such as increased glycosaminoglycan (GAGs) and
heparan sulfate-proteoglycan (HS-PGs) synthesis [23], such as
syndecan [24], and perlecan, a mixed heparan sulfate/chondroitin
sulfate proteoglycan [25] localized at the skin basement membrane
zone. The present study was designed to analyze the biological
effects of C-Xyloside on dermal-epidermal junction morphogenesis in
the reconstructed skin model, with particular attention on the
fibrillar and structural components of the DEJ.
Materials and methods
Keratinocyte and fibroblast cultures
Normal human skin was obtained from mammary reduction after
patient’s informed consent. Normal human epidermal keratinocytes
(NHK) were isolated and cultured as described by Rheinwald and
Green on a feeder layer of Swiss 3T3 fibroblasts [26]. Human dermal
fibroblasts were isolated after spreading from mammary skin
explants and cultured in DMED 10% fetal calf serum.
In vitro reconstructed skin [27]
Dermal equivalents were prepared using 7 mL of a mixture
containing 106 human dermal fibroblasts and
1.5 mg/mL native bovine type I collagen (Symatèse, France) in
a 60 mm petri dish. The dermal equivalents were allowed to
contract for 3 days at 37 °C, 5% CO2. Human epidermal
keratinocytes grown in primary culture (33,000/cm2) were
seeded on this support using stainless rings. After 2 h rings
were removed and cultures were kept submerged for 7 days. The
culture was then raised at the air-liquid interface (day 0) and
kept up for 8 or 11 days. The medium was as described [28] and
changed 3 times per week.
Test product and treatment
C-β-D-xylopyranoside-2-hydroxy-propane (C-Xyloside,
Pro-xylaneTM) was obtained from L’Oréal Research
Laboratories (France). It was freshly prepared before each use and
diluted in culture medium. Cytotoxicity was assessed using the MTT
test in dermal fibroblasts, seeded at 12,500 cells per well (96
well plates), cultured for 24 hours without (control) then for 24
hours with test product (C-Xyloside treated) before MTT test.
For gene expression analysis, human dermal fibroblasts were
treated with C-Xyloside in a medium containing 1% fetal calf serum
for 18h. Each experiment was performed in triplicate.
For DEJ protein analysis, reconstructed skin samples were
treated with C-Xyloside added to culture medium from the last
medium change of the immersion phase, and then at each medium
change during the emerged culture period (air-liquid interface).
Five different experiments were done using duplicates for each
experimental condition.
Histology
Reconstructed skin samples were fixed in neutral formalin. Paraffin
sections were stained with haematoxylin, eosin, and saffron.
Immunostaining
Immunolabelling was performed on air-dried vertical 5 μm
cryosections of reconstructed skin samples. Mouse monoclonal
antibodies were against: human type IV collagen (CIV22,
Dako, Denmark, 1/10); type VII collagen (LH7.2 Chemicon Inter, USA,
1:200); fibrillin-1 (11C1.3, Southern Biotechnology Associates,
USA, 1:50), laminin 5 (clone GB3, gift from Dr G Meneguzzi, Nice
France, undiluted). Rat monoclonal antibodies were against type I
procollagen (M-58, Chemicon Inter, USA, 1:100). Fluorescein
isothiocyanate (FITC)-conjugate rabbit anti-mouse immunoglobulins
(1:80) or FITC-conjugate swine anti-rabbit immmunoglobulins (1:40)
or FITC-conjugate rabbit anti-rat immmunoglobulins (1:200), (Dako,
Denmark), were used as second antibodies. Nuclear counterstaining
using propidium iodide was carried out routinely.
Ten different fields per experimental condition were quantified
for staining intensity using the Q-Fluoro Leica software. Values
are given as arbitrary units.
RNA extraction and quantitative PCR
Dermal fibroblasts were rinsed in PBS Dulbecco’s without calcium
and magnesium (Gibco BRL), immersed in Tri-Reagent (Sigma T9424).
Total RNA was extracted according to manufacturer’s instructions
followed by chloroform extraction and isopropanol precipitation.
Contaminant DNA was removed using DNA-free system (Ambion)
according to manufacturer’s instructions.
Reverse transcription was performed in the presence of oligo
(DT) primer and Superscript II enzyme (Gibco). Quantification of
cDNA was performed and adjusted at 50 ng/mL. Quantitative PCR
were performed using the Light Cycler (Roche Molecular Systems,
Inc.) according to manufacturer’s instructions. Primers were
designed to be specific for collagen IV α1 chain (Forward
CCTCGCTGTGGATCGGCTACTC, Reverse GCTTCTTGAACATCTCGCTCCTCTC) and
collagen VII α1 chain (Forward GGCTCGCACTGACGCTTCTG, Reverse
TCCAGCAGAGTGTAGAGTGTGAGG). Normalization of the quantities of mRNA
was performed using a beta actin gene (Forward GGACTTCGAGCAAGATGG
Reverse AGGAAGGAAGGCTGGAAGAG). Levels for mRNA were expressed in
arbitrary units. The mRNA levels of the gene concerned were
considered 100% for the untreated condition. Experiments were
performed in triplicate.
Statistical analysis
The statistical significance was determined with Student’s t test
(p < 0.05 was considered to be statistically significant).
Results
Cytotoxicity assessement
Dermal fibroblasts were incubated with increasing concentration
(ranging from 0 to 10 mg/mL) of C-Xyloside for 24 hours. MTT test
was performed and revealed no cytotoxic effects even at high
concentration (table 1).
Table 1 Evaluation of cytotoxicity according to
C-Xyloside concentration added to culture medium. Morphological
score +: normal aspect, ±: slight morphological changes, -:
cytotoxic effect, decrease in cell number
|
C-Xyloside Concentration (mg/mL)
|
0
|
1.28 10-4
|
6 10-4
|
0.032
|
0.016
|
0.08
|
0.4
|
2
|
10
|
|
MTT Values
|
100
|
95
|
93
|
92
|
93
|
93
|
106
|
96
|
97
|
|
Morphological score
|
+
|
+
|
+
|
+
|
+
|
+
|
+
|
±
|
±
|
mRNA levels for collagen VII α1 and collagen IV α1 in dermal
fibroblasts
Concentrations of 0.08 and 0.4 mg/mL of C-Xyloside were chosen to
assess their effect on gene expression. Treatment of dermal
fibroblasts with C-Xyloside for 18 h induced an increase in
mRNA levels for collagen VII α1 by 201% (p < 0.01) at
0.08 mg/mL and 357% at 0.4 mg/mL (p < 0.01). Collagen
IV α1 gene expression was slightly increased by 112% at
0.08 mg/mL (not significant) and 136% at 0.4 mg/mL
(tendency, p = 0.13) compared to control cells.
C-Xyloside does not interfere with the epidermal morphogenesis
of reconstructed skin models
Histological examinations of the samples of reconstructed skin were
performed at day 8 of the air liquid interface culture period,
which corresponds to the time needed for a complete epidermal
differentiation and formation of the horny layer [29]. Some samples
were also analysed at day 11 of air-liquid interface period. Test
concentrations of C-Xyloside were 0.08 mg/mL and
0.16 mg/mL.
Control reconstructed skins at day 8 present a fully
differentiated epidermis with granular and horny layers (figure 1). At day 11, the
thickness of horny layer was increased. Morphological analysis of
reconstructed skins treated with C-Xyloside revealed a normal
appearance without any alterations in the epidermal differentiation
(figure 1). Even
at day 11, C-Xyloside-supplemented reconstructed skins displayed
similar morphological features compared to controls.
Histological examination of dermal fibroblasts embedded in the
collagen matrix did not reveal differences between control and
C-Xyloside treated samples (figure 1).
C-Xyloside improves the deposition of basement membrane
proteins in the reconstructed skin model
The reconstructed skin model in vitro based on the use of
contracted collagen gel as a dermal support needs a complete de
novo morphogenesis of the basement membrane compartment to achieve
a functional DEJ [21]. The deposition of specific DEJ proteins such
as type IV collagen, type VII collagen and laminin 5 were analysed
by immunostaining. At day 8, these proteins were weakly expressed
in control samples and often visualized as a punctiform staining at
the DEJ zone. In C-Xyloside exposed samples, increased levels of
these proteins were found at DEJ area with a linear distribution
(table 2, figure 2).
Table 2 Quantitative analysis of immunostainings.
Treated samples were compared to control samples and statistical
analysis was performed using the Student’s t test (** p <
0.05)
|
Control
|
C-Xyloside 0.08 mg/mL
|
C-Xyloside 0.16 mg/mL
|
|
Collagen IV
|
55.59 ± 1.22
|
60.84 ± 1.78 ** (p = 0.031)
|
69.74 ± 0.99 ** (p < 0.001)
|
|
Collagen VII
|
53.22 ± 0.37
|
56.74 ± 0.88 ** (p = 0.001)
|
59.88 ± 1.85 ** (p = 0.002)
|
|
Laminin 5
|
68.34 ± 0.43
|
76.25 ± 1.32** (p < 0.001)
|
70.57 ± 0.90** (p = 0.034)
|
|
Pro-collagen I
|
58.51 ± 1.38
|
74.93 ± 2.27** (p < 0.001)
|
65.05 ± 1.72 ** (p = 0.008)
|
|
Fibrillin 1
|
49.85 ± 0.26
|
51.84 ± 0.77** (p = 0.02)
|
54.97 ± 0.96** (p < 0.001)
|
C-Xyloside improves the deposition of extracellular matrix
proteins in the superficial dermis
Deposition of extracellular matrix proteins such as pro-collagen 1
and fibrillin 1 was assessed by immunostaining on control and
C-Xyloside treated reconstructed skins. In control samples,
staining for procollagen 1 was weak, positive in the whole dermal
equivalent with a slightly higher intensity in the upper part of
the dermis. C-Xyloside treated samples showed an increase in the
staining specifically localized underneath the epidermis (figure 3). The
fibrillin 1 staining in control samples was almost negative.
C-Xyloside-supplemented samples showed a higher staining intensity
for fibrillin 1, with thin fibers especially localized in the upper
part of the dermal equivalent (table 2,
figure 3).
Discussion
In the present study, we investigated the effects of a new
xylopyranoside derivative, C-Xyloside, on dermal epidermal junction
proteins. The use of a reconstructed skin model allowed major DEJ
proteins to be visualized and localized during its reconstruction,
thus confirming that organotypical models including both the
epidermis and living dermal fibroblasts represent suitable models
for studying DEJ morphogenesis [19, 21, 30, 31]. We first showed
that, when added during epidermal morphogenesis, C-Xyloside did not
interfere with the normal epidermal differentiation programme. This
suggests that such a sugar derivative is not responsible for
cytotoxic or deleterious effects on normal human cells, even after
an 11 day contact, which represents a relatively long treatment for
an in vitro morphogenetic system.
Our data showed that C-Xyloside induced higher deposition of
several basement membrane and upper dermis components involved in
the correct architecture and function of DEJ. We observed i) an
increase in the production of collagen IV, the major component of
lamina densa, ii) a higher production of laminin 5, corresponding
to anchoring microfilaments responsible for connections between
hemidesmosomes and lamina densa, and iii) an increased amount of
collagen VII corresponding to anchoring fibrils. A better collagen
IV scaffold on the dermal substrate as well as higher amounts of
laminin 5 strengthen the attachment of keratinocytes onto the
basement membrane [32, 33]. An increased number of collagen VII
microfibrils might enhance the dermal epidermal adherence [34].
These biological activities seem crucial regarding the role of the
DEJ zone in skin cohesion and resistance to mechanical stress.
Defects of functional laminin 5 or collagen VII lead to dramatic
skin fragility and proneness to blistering, as illustrated in
patients affected with epidermolysis bullosa [9]. In more
physiological conditions, such as the ageing process, decreased
collagen VII may be related to increased skin fragility [11].
Finally our study also revealed that extracellular matrix proteins
such as pro-collagen I and fibrillin 1 which represent major dermal
fibrillar components, were increased. These structural proteins are
responsible for the firmness and elasticity of the papillary dermis
in human skin It has also been shown that collagen VII interacts
both with the basement membrane laminin 5 and collagen IV
components and with the collagen I fibers [35, 36]. Taken together,
these effects indicate a more mature DEJ after C-Xyloside
treatment.
In a first attempt to understand the molecular mode of action of
the xylose derivative, mRNA levels for collagen VII α1 and collagen
IV α1 genes were measured in dermal fibroblasts and found to be
upregulated after C-Xyloside treatment, suggesting a
transcriptional regulation. It has been previously shown that the
regulation of collagen genes mostly occurred at the transcriptional
level [37]. However, further investigations have to be performed to
better characterize the transcriptional regulation and eventually
to identify the related responsive element(s). Previous studies
have demonstrated that C-Xyloside increased GAG and HS-PG
expression [23]. Through their ability to capture and store growth
factors and cytokines [38, 39], they may indirectly be responsible
for the up-regulation of collagen genes. The collagen VII gene was
shown to be upregulated in dermal fibroblasts by several cytokines
[40, 41]. Interactions between both compartments through the
release of soluble factors have also been reported to influence the
basement membrane zone [42]. It has also been shown that
proteoglycans can modify the balance between proteases and
antiproteases. The implications of such biological activity have
been illustrated in wound fluids for syndecans, thus suggesting a
role in the wound healing process [43]. However, we did not find
any modulation in MMP-2 levels after C-Xyloside treatment (data not
shown). In addition, direct interactions between GAGs/PGs and
fibrillar matrix proteins were previously reported. Perlecan, a
basement membrane HS-PG is able to bind and accelerate collagen
fibril formation [44]. Perlecan can also bind to collagen IV,
nidogen, laminin and fibronectin within the basement membrane as
well as with collagen I [45, 46]. Syndecan, another HS-PG can
directly bind to laminin 5 [47]. It has to be stressed that both of
these HS-PGs are induced by C-Xyloside. Further analysis of levels
of various cytokines, growth factors and MMPs may help in
understanding the biological activities of C-Xyloside.
In conclusion, our findings indicate that, in addition to
stimulating GAG and HS-PG synthesis, C-Xyloside increases the
expression of collagen genes and deposition of key proteins
involved in the functional DEJ, thus strongly suggesting beneficial
effects on defective DEJ from restoring or improving its soundness
and cohesion.
Acknowledgments
We would like to thank Dr G Meneguzzi for generous gift of the GB3
antibody. Financial support: none. Conflict of interest: none.
References
1 Kerscher M, Williams S, Dubertret L. Cosmetic
dermatology and skin care. Eur J Dermatol 2007; 17: 180-2.
2 de Rigal J, Escoffier C, Querleux B,
Faivre B, Agache P, Leveque JL. Assessment of aging
of the human skin by in vivo ultrasonic imaging. J Invest Dermatol
1989; 93: 621-5.
3 Richard S, Querleux B, Bittoun J,
Jolivet O, Idy-Peretti I, de Lacharriere O,
Leveque JL. Characterization of the skin in vivo by high
resolution magnetic resonance imaging: water behavior and
age-related effects. J Invest Dermatol 1993; 100: 705-9.
4 Chung JH, Seo JY, Choi HR, Lee MK,
Youn CS, Rhie G, Cho KH, Kim KH, Park KC,
Eun HC. Modulation of skin collagen metabolism in aged and
photoaged human skin in vivo. J Invest Dermatol 2001; 117:
1218-24.
5 Varani J, Dame MK, Rittie L, Fligiel SE,
Kang S, Fisher GJ, Voorhees JJ. Decreased collagen
production in chronologically aged skin: roles of age-dependent
alteration in fibroblast function and defective mechanical
stimulation. Am J Pathol 2006; 168: 1861-8.
6 Varani J, Warner RL, Gharaee-Kermani M,
Phan SH, Kang S, Chung JH, Wang ZQ,
Datta SC, Fisher GJ, Voorhees JJ. Vitamin A
antagonizes decreased cell growth and elevated collagen-degrading
matrix metalloproteinases and stimulates collagen accumulation in
naturally aged human skin. J Invest Dermatol 2000; 114: 480-6.
7 Lavker RM. Cutaneous aging: chronologic versus
photoaging. In: Gilchrest BA, ed. Photodamage. Cambridge USA:
Blackwell Science Inc., 1995: 123-35.
8 Yaar M. Clinical and histological features of intrinsic
versus extrinsic aging. In: B A Gilchrest JK, ed. Skin aging.
2006: 9-21; (Berlin).
9 Burgeson RE, Christiano AM. The dermal-epidermal
junction. Curr Opin Cell Biol 1997; 9: 651-8.
10 Woodley DT, Chen M. The basement membrane zone. In:
Freinkel RK, Woodley DT, eds. The Biology of the Skin.
New York: The Parthenon Publishing Group, 2001: 133-52.
11 Craven NM, Watson RE, Jones CJ,
Shuttleworth CA, Kielty CM, Griffiths CE. Clinical
features of photodamaged human skin are associated with a reduction
in collagen VII. Br J Dermatol 1997; 137: 344-50.
12 Contet-Audonneau JL, Jeanmaire C, Pauly G. A
histological study of human wrinkle structures: comparison between
sun-exposed areas of the face, with or without wrinkles, and
sun-protected areas. Br J Dermatol 1999; 140: 1038-47.
13 Talwar HS, Griffiths CE, Fisher GJ,
Hamilton TA, Voorhees JJ. Reduced type I and type III
procollagens in photodamaged adult human skin. J Invest Dermatol
1995; 105: 285-90.
14 Watson RE, Griffiths CE, Craven NM,
Shuttleworth CA, Kielty CM. Fibrillin-rich microfibrils
are reduced in photoaged skin. Distribution at the dermal-epidermal
junction. J Invest Dermatol 1999; 112: 782-7.
15 Finch PW, Rubin JS, Miki T, Ron D,
Aaronson SA. Human KGF is FGF-related with properties of a
paracrine effector of epithelial cell growth. Science 1989; 245:
752-5.
16 Hirai Y, Takebe K, Takashina M,
Kobayashi S, Takeichi M. Epimorphin: a mesenchymal
protein essential for epithelial morphogenesis. Cell 1992; 69:
471-81.
17 Lavker RM. Structural alterations in exposed and
unexposed aged skin. J Invest Dermatol 1979; 73: 59-66.
18 Stoker AW, Streuli CH, Martins-Green M,
Bissell MJ. Designer microenvironments for the analysis of
cell and tissue function. Curr Opin Cell Biol 1990; 2: 864-74.
19 Fleischmajer R, MacDonald ED, Contard P,
Perlish JS. Immunochemistry of a keratinocyte-fibroblast
co-culture model for reconstruction of human skin. J Histochem
Cytochem 1993; 41: 1359-66.
20 Marinkovich MP, Keene DR, Rimberg CS,
Burgeson RE. Cellular origin of the dermal-epidermal basement
membrane. Dev Dyn 1993; 197: 255-67.
21 Marionnet C, Pierrard C, Vioux-Chagnoleau C,
Sok J, Asselineau D, Bernerd F. Interactions between
fibroblasts and keratinocytes in morphogenesis of dermal epidermal
junction in a model of reconstructed skin. J Invest Dermatol 2006;
126: 971-9.
22 Marionnet C, Vioux-Chagnoleau C, Pierrard C,
Sok J, Asselineau D, Bernerd F. Morphogenesis of
dermal-epidermal junction in a model of reconstructed skin:
beneficial effects of vitamin C. Exp Dermatol 2006; 15: 625-33.
23 Pineau N, Bernerd F, Dalko-Csiba M,
Breton L. A new C-xylopyranoside derivative induces skin
expression of glucosaminoglycans and heparan sulphate
proteoglycans. Eur J Dermatol 2008; 18(1): 36-40.
24 Maatta A, Jaakkola P, Jalkanen M.
Extracellular matrix-dependent activation of syndecan-1 expression
in keratinocyte growth factor-treated keratinocytes. J Biol Chem
1999; 274: 9891-8.
25 Kvist AJ, Johnson AE, Morgelin M,
Gustafsson E, Bengtsson E, Lindblom K,
Aszodi A, Fassler R, Sasaki T, Timpl R,
Aspberg A. Chondroitin sulfate perlecan enhances collagen
fibril formation. Implications for perlecan chondrodysplasias. J
Biol Chem 2006; 281: 33127-39.
26 Rheinwald JG, Green H. Serial cultivation of
strains of human epidermal keratinocytes: the formation of
keratinizing colonies from single cells. Cell 1975; 6: 331-43.
27 Asselineau D, Bernhard B, Bailly C,
Darmon M. Epidermal morphogenesis and induction of the 67 kD
keratin polypeptide by culture of human keratinocytes at the
liquid-air interface. Exp Cell Res 1985; 159: 536-9.
28 Bernerd F, Vioux C, Asselineau D. Evaluation
of the protective effect of sunscreens on in vitro reconstructed
human skin exposed to UVB or UVA irradiation. Photochem Photobiol
2000; 71: 314-20.
29 Bernerd F, Asselineau D. Successive alteration and
recovery of epidermal differentiation and morphogenesis after
specific UVB-damages in skin reconstructed in vitro. Dev Biol 1997;
183: 123-38.
30 Boyce ST, Supp AP, Swope VB, Warden GD.
Vitamin C regulates keratinocyte viability, epidermal barrier, and
basement membrane in vitro, and reduces wound contraction after
grafting of cultured skin substitutes. J Invest Dermatol 2002; 118:
565-72.
31 el Ghalbzouri A, Jonkman MF, Dijkman R,
Ponec M. Basement membrane reconstruction in human skin
equivalents is regulated by fibroblasts and/or exogenously
activated keratinocytes. J Invest Dermatol 2005; 124: 79-86.
32 Takeda A, Kadoya K, Shioya N, Uchinuma E,
Tsunenaga M, Amano S, Nishiyama T, Burgeson RE.
Pretreatment of human keratinocyte sheets with laminin 5 improves
their grafting efficiency. J Invest Dermatol 1999; 113: 38-42.
33 Dawson RA, Goberdhan NJ, Freedlander E,
MacNeil S. Influence of extracellular matrix proteins on human
keratinocyte attachment, proliferation and transfer to a dermal
wound model. Burns 1996; 22: 93-100.
34 Burgeson RE. Type VII collagen, anchoring fibrils, and
epidermolysis bullosa. J Invest Dermatol 1993; 101: 252-5.
35 Chen M, Marinkovich MP, Veis A, Cai X,
Rao CN, O’Toole EA, Woodley DT. Interactions of the
amino-terminal noncollagenous (NC1) domain of type VII collagen
with extracellular matrix components. A potential role in
epidermal-dermal adherence in human skin. J Biol Chem 1997; 272:
14516-22.
36 Keene DR, Sakai LY, Lunstrum GP,
Morris NP, Burgeson RE. Type VII collagen forms an
extended network of anchoring fibrils. J Cell Biol 1987; 104:
611-21.
37 Bornstein P, Sage H. Regulation of collagen gene
expression. Prog Nucleic Acid Res Mol Biol 1989; 37: 67-106.
38 Mongiat M, Otto J, Oldershaw R, Ferrer F,
Sato JD, Iozzo RV. Fibroblast growth factor-binding
protein is a novel partner for perlecan protein core. J Biol Chem
2001; 276: 10263-71.
39 Tkachenko E, Rhodes JM, Simons M. Syndecans:
new kids on the signaling block. Circ Res 2005; 96: 488-500.
40 Mauviel A, Lapiere JC, Halcin C,
Evans CH, Uitto J. Differential cytokine regulation of
type I and type VII collagen gene expression in cultured human
dermal fibroblasts. J Biol Chem 1994; 269: 25-8.
41 Vindevoghel L, Lechleider RJ, Kon A, de
Caestecker MP, Uitto J, Roberts AB, Mauviel A.
SMAD3/4-dependent transcriptional activation of the human type VII
collagen gene (COL7A1) promoter by transforming growth factor beta.
Proc Natl Acad Sci USA 1998; 95: 14769-74.
42 Pageon H, Bakala H, Monnier VM,
Asselineau D. Collagen glycation triggers the formation of
aged skin in vitro. Eur J Dermatol 2007; 17: 12-20.
43 Kainulainen V, Wang H, Schick C,
Bernfield M. Syndecans, heparan sulfate proteoglycans,
maintain the proteolytic balance of acute wound fluids. J Biol Chem
1998; 273: 11563-9.
44 Kvist AJ, Johnson AE, Morgelin M,
Gustafsson E, Bengtsson E, Lindblom K,
Aszodi A, Fassler R, Sasaki T, Timpl R,
Aspberg A. Chondroitin sulfate perlecan enhances collagen
fibril formation. Implications for perlecan chondrodysplasias. J
Biol Chem 2006; 281: 33127-39.
45 Bengtsson E, Morgelin M, Sasaki T,
Timpl R, Heinegard D, Aspberg A. The leucine-rich
repeat protein PRELP binds perlecan and collagens and may function
as a basement membrane anchor. J Biol Chem 2002; 277: 15061-8.
46 Timpl R. Macromolecular organization of basement
membranes. Curr Opin Cell Biol 1996; 8: 618-24.
47 Okamoto O, Bachy S, Odenthal U,
Bernaud J, Rigal D, Lortat-Jacob H, Smyth N,
Rousselle P. Normal human keratinocytes bind to the
alpha3LG4/5 domain of unprocessed laminin-5 through the receptor
syndecan-1. J Biol Chem 2003; 278: 44168-77.
|
Printable version
Version PDF
