Home > Journals > Medicine > European Journal of Dermatology > Full text
 
      Advanced search    Shopping cart    French version 
 
Latest books
Catalogue/Search
Collections
All journals
Medicine
European Journal of Dermatology
- Current issue
- Archives
- Subscribe
- Order an issue
- More information
Biology and research
Public health
Agronomy and biotech.
My account
Forgotten password?
Online account   activation
Subscribe
Licences IP
- Instructions for use
- Estimate request form
- Licence agreement
Order an issue
Pay-per-view articles
Newsletters
How can I publish?
Journals
Books
Help for advertisers
Foreign rights
Book sales agents



 

Texte intégral de l'article
 
  Printable version

Tumor necrosis factor alpha induces upregulation of CXC-chemokine receptor type II expression and magnifies the proliferative activity of CXC-chemokines in human melanocytes


European Journal of Dermatology. Volume 13, Number 2, 124-9, March - April 2003, Synthèses


Summary  

Author(s) : Johannes NORGAUER, Stefan DICHMANN, Frank PETERS, Maja MOCKENHAUPT, Ingrid SCHRAUFSTÄTTER, Yared HEROUY, Department of Experimental Dermatology, University of Freiburg, Hauptstr. 7, D-79104 Freiburg, Germany.

Summary : The CXC-chemokines Groalpha and interleukin-8 (IL-8) are ligands for two different G protein-coupled receptors, named CXC-chemokine receptor I & II (CXCRI & II). Both cytokines are potent growth factors for human melanoma cells, with only limited proliferative activity towards normal melanocytes. Here we analysed the influence of various cytokines on the expression of CXCRI & II and the CXC-chemokine-induced proliferation in human melanocytes. Flow cytometric studies revealed no protein expression of CXCRI and low protein expression of CXCRII at the cell surface of normal melanocytes. Tumor necrosis factor alpha (TNFalpha) enhanced the mRNA and protein expression of CXCRII, but did not influence expression of CXCRI. A consequence of TNFalpha-pretreatment of human melanocytes was a significant enhancement of the proliferative activity of IL-8 and Groalpha. This study implicates that TNFalpha magnifies the biological activity of CXC-chemokines in melanocytes by induction of CXCRII expression.

Keywords : melanocytes, tumor necrosis factor alpha, CXC-chemokines

Pictures

ARTICLE

Human melanocytes are secretory neural crest-derived cells located within the basal layer of the epidermis and in the matrix of hair follicles. The main function of melanocytes is the synthesis of melanin pigment, which is transferred to basal keratinocytes [1]. Melanization is responsible for skin tanning, protection against ultraviolet damage and photocarcinogenesis [2]. In the adult epidermis melanocyte mitosis occurs rarely, but the cells can proliferate under physiological stimuli such as ultraviolet radiation and wound healing [1-2]. Recent development of cell culture systems allowing the generation of a large population of normal melanocytes enhanced our knowledge of proliferation control of melanocytes. In vitro requires synergistic mitogens in order to proliferate. The best characterised growth factors for human melanocytes are fibroblast growth factor 1 & 2, hepatocyte growth factor/scatter factor, mast/stem cell factor, endothelins and melanotropin [3-6]. The proper function of these factors is likely to be important in vivo, as all ligands are produced in the skin, and elimination or overexpression of these ligands alters the normal distribution of melanocytes [3]. In contrast to these growth stimulating factors, interleukin-1 and 6 as well as tumor necrosis factor alpha show inhibitory properties [7].


Interleukin-8 or Groalpha are well characterised peptides of the CXC-chemokine family consisting of 72 amino acids [8, 9]. The amino acid sequences of these molecules are 42% identical [8-10]. CXC-chemokines are produced by a variety of tissues including monocytes, fibroblasts, keratinocytes and melanocytic cells [8-12]. They have chemotactic activity for neutrophils and serve as strong growth factors in melanoma cells, with only limited proliferative activity towards normal melanocytes[11-13]. Two different G-protein-coupled receptors for CXC-chemokines in mammalian cells have been identified, termed CXC-chemokine receptor I & II (CXCR1 & 2) [14, 15]. Their amino acid sequences are 73% identical with most of the differences clustered at the NH2- and COOH-termini [16]. Interleukin-8 binds to both receptors with high affinity, whereas Groalpha interacts with high affinity to the CXCR2 and with low affinity to the CXCR1 [16, 17]. Cell activation requires high affinity ligand binding interaction, whereas low affinity binding of Groalpha with the CXCR1 did not initiate signal transduction at physiologically relevant concentrations [16-18].


Recently, evidence has been provided that cell surface expression of CXCR1 & 2 is controlled by transcriptionally regulated protein synthesis [19-21]. Here we analysed in melanocytes the influence of various cytokines on the expression of CXCR1 & 2 and the CXC-chemokine-induced proliferation.


Materials and methods


Recombinant human Groalpha, interleukin-8 (IL-8), tumor necrosis factor alpha (TNFalpha), interleukin-1beta (IL-1beta),
interleukin-6 (IL-6) and interferon-gamma (INFgamma) were from PeproTech (London, UK); interleukin-4 (IL-4), interleukin-13 (IL-13), granulocyte-colony stimulating factor (GCSF), basic fibroblast growth factor, endothelin-1, alpha-melanocyte stimulating hormone, melanocyte growth medium supplemented with bovine pituitary extract, 1 mug/l basic fibroblast growth factor (bFGF), 10 mug/l phorbol 12-myristate 13-acetate (PMA), 5 mg/l insulin, 500 mug/l hydrocortisone, 0.8% (v/v) gentamycin and 0.8% (v/v) amphotericin B, was from Promocell (Heidelberg, Germany); actinomycin D, phorbol 12-myristate 13-acetate (PMA) and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT) was from Sigma (Deisenhofen, Germany); GeneAmp RNA PCR kit was from Perkin Elmer (Norwalk, CT); TA cloning kit was from Invitrogen (Leek, Netherlands); fluorescein-labeled goat f(ab')2-fragments anti-rabbit f(ab')2-fragments were from Dianova (Hamburg, Germany); fluorescein-conjugated anti-bromodeoxyuridine F(ab)2-fragments from Boehringer (Mannheim, Germany), polyclonal rabbit anti-human CXC-chemokine receptor type I IgG (N-19) from Santa Cruz (Santa Cruz, CA); polyclonal rabbit anti-human CXC chemokine receptor type II IgG was described [22].


Cell culture of normal human melanocytes


Human melanocytes were isolated from freshly prepared foreskin and maintained melanocyte growth medium (MGM) supplemented with bovine pituitary extract, 1 mug/l basic fibroblast growth factor (bFGF), 10 mug/l phorbol 12-myristate 13-acetate (PMA), 5 mg/l insulin, 500 mug/l hydrocortisone, 0.8% (v/v) gentamycin and 0.8% (v/v) amphotericin B as described [22].


Reverse transcription and polymerase chain reaction


The mRNA expression of CXCR I and II was analysed semiquantitatively by reverse transcription followed by polymerase chain reaction as described [23]. Total mRNA was isolated by guanidinium-phenol-chloroform extraction and cDNA was obtained with the GeneAmp RNA PCR kit (Perkin Elmer, Norwalk, CT). Specific cDNA were amplified by polymerase chain reaction (PCR) using CCTGTATGCTAGAAAC3' and 5'TTCGTCTGTCAATGTCTC3' as primers for CXCRI, 5'CCTTTTCTACTAGATGCCGC 3' and 3'GAAACAACCGAGAAGAAG5' for the CXCRII, 5'CCACCCATGGCAGCAAATTCCATGGCA3' and 3'AGTGGACCTGACCTGCCGTGTAGA5' for the house keeping gene GAPDH. Amplification was performed in an automatic temperature cycler with 30 cycles at 95 °C, 60 °C and 72 °C (1 min each). In order to assure linear cDNA amplification different amplifying cycles (22-36) were checked. Linear amplification quantifying the optical density of the generated bands were obtained between 22 and 32 cycles. The specificity of the generated products were proven by sequencing after cloning using pCR®II vector (Invitrogen, Leek, Netherlands).


Analysis of protein expression of CXCRI and II by flow cytometry


Cells were incubated with f(ab')2-fragments against the indicates receptors for 30 min on ice. Bound f(ab')2-fragments were stained with fluorescein-conjugated goat f(ab')2-fragment anti-rabbit f(ab')2-fragments (Dianova, Hamburg, Germany). Fluorescence profiles were analysed by flow cytometry [22].


Proliferation assays


Normal human melanocytes were plated in flat-bottomed 96-well plates containing MGM culture medium supplemented with bovine pituitary extract, 1 mug/l basic fibroblast growth factor (bFGF), 10 mug/l phorbol 12-myristate 13-acetate (PMA), 5 mg/l insulin, 500 mug/l hydrocortisone, 0.8% (v/v) gentamycin and 0.8% (v/v) amphotericin B for 10 h. Thereafter medium was removed, and the cells were maintained in MGM medium without supplementation for 16 h. Indicated concentrations of stimuli were added to the cell culture and proliferation was evaluated by MTT-test [22] or by 5-bromo-2'-deoxyuridine incorporation [24].


Results


Two G-protein coupled receptors for the CXC-chemokines IL-8 and Groalpha have been identified. To analyse the expression of these receptors at the cell surface of normal melanocytes flow cytometric studies with specific antibodies were performed. The higher fluorescence profile in cells incubated with f(ab')2-fragments against the CXCRII in comparison to control f(ab')2-fragments indicates expression of this receptor in melanocytes (Fig. 1A). In contrast, no indication for protein expression of CXCRI in melanocytes could be found (data not shown). The transcriptionally regulated expression of CXCRI & II can be controlled by various cytokines in leukocytes [19-21]. Next, the influence of cytokines, growth factors and pharmacological agents such as tumor necrosis factor alpha (TNFalpha), interleukin-1beta (IL-1beta), interleukin-4 (IL-4), interleukin-6 (IL-6), interleukin-13 (Il-13), interferon-gamma (INFgamma), granulocyte-colony stimulating factor (GCSF), forskolin, phorbol ester and a growth factor cocktail consisting of basic fibroblast growth factor, endothelin-1 and alpha-melanocyte stimulating hormone on CXCRII protein expression at the cell membrane was analysed. Significant enhanced expression of CXCRII after incubation with TNFalpha was already observed after 24 h and more pronounced after 48 h (Fig. 1B). The effect of TNFalpha was concentration dependent with half-maximal and maximal effects at 2 ng and 20 ng/ml, respectively. In addition, no protein expression of CXCRI after treatment with the described cytokines were found in melanocytes (data not shown). All other tested agents had no significant effect (Table I).

Expression of CXCRII in melanocytes after stimulation with various stimuli. Melanocytes were incubated with and without 20 ng/ml TNFalpha, 10 - 6 M phorbol ester, 100 U/ml IL-1beta, 20 ng/ml IL-4, 100 U/ml IL-6, 20 ng/ml IL-13, 100 U/ml INFgamma, 50 ng/ml GCSF, 10 - 5 M forskolin and a growth factor cocktail of 0.6 ng/ml basic fibroblast growth factor, 10 nM endothelin-1 and 10 nM alpha-melanocyte-stimulating hormone for 24 h or 48 h. Thereafter the expression of CXCRII at the cell surface was analysed by flow cytometry and specific bound fluorescence deltaFL (difference of the mean fluorescence channel in the presence of control or CXCRII antibodies) was calculated. Data are means ± SD (n = 3).


To determine whether TNFalpha-induced CXCRII expression was due to transcriptionally regulated de novo protein synthesis, experiments with the transcription inhibitor actinomycin D were performed. Control cells in its absence and presence showed a mean fluorescence of 185 ± 27 and 154 ± 19 channels. TNFalpha enhanced the CXCRII expression to 645 ± 42 channels, whereas optimal concentrations of actinomycin D inhibited completely the TNFalpha effect reducing the fluorescence to 192 ± 24 channels. To analyse the mRNA expression of CXCRII in melanocytes semi-quantitative RT-PCR experiments were performed. As shown in Fig. 2A, the expected CXCRII-product with 969 bases and the GAPDH product were detected. In contrast, no product was obtained with primers for CXCRI. The cytokine TNFalpha enhanced in a concentration-dependent manner the CXCRII expression (Fig. 2B). Again, no product was obtained with primers for CXCRI in samples of TNFalpha-treated melanocytes (data not shown). In addition, no generated PCR-products were obtained omitting MMLV reverse transcriptase in the reaction with all samples (data not shown).


To analyse the function of altered CXCRII expression, proliferation tests with bromodesoxyuridine (Fig. 3A and B) and MTT (Fig. 3C and D) were performed. As already reported the CXC-chemokines IL-8 and Gro had a proliferative activity in normal melanocytes [13]. In accordance with the literature, TNFalpha itself inhibited the proliferation response in melanocytes [7]. However the addition of CXC-chemokines to TNFalpha- preincubated melanocytes not only reversed the inhibitory effect of TNFalpha, but provoked a strong proliferative activity in melanocytes in a dose dependent manner. Next, we address the kinetic of TNFalpha effect on CXC-chemokine-induced proliferation (Table II). The effect of TNFalpha was time dependent with half-maximal and maximal effects after 24-26 h and 48-60 h, respectively.

 


Discussion


CXC-chemokines have been implicated in causing and/or amplifying inflammatory processes [8]. In addition they act as an autocrine growth factor in malignant melanoma, promote melanocyte transformation, but have only limited proliferative activity towards normal melanocytes [9, 13, 22]. Previously it has been shown that reactivity of cells towards CXC-chemokines can be controlled by cytokine-induced expression of CXC-chemokine receptor [19-21]. These reports prompted us to analyse which commonly expressed cytokines in the skin influence the expression of CXCR and the proliferative activity of CXC-chemokines in normal human melanocytes.


In this study we demonstrated that normal melanocytes constitutively express CXCRII mRNA and protein, whe reas we found no indication for the expression of CXCRI. Flow cytometric studies performed here revealed that expression of CXCRII could be up-regulated in a time and concentration-dependent manner by TNFalpha, whereas IL-1, IL-4, IL-6, IL-13, INFgamma, GCSF, phorbol ester, forskolin, and a growth factor cocktail consisting of basic fibroblast growth factor, endothelin-1 as well as alpha-melanocyte stimulating hormone provoked no significant alterations. Regulation of CXCRII expression has been previously reported in granulocytes by granulocyte colony-stimulating factor and in monocytes by interleukin-4 and-interleukin-13 [19-21]. In addition, we have shown here inhibition of the TNFalpha effect on CXCRII expression by the transcription blocking agent actinomycin D and we have reported here enhanced CXCRII mRNA levels after stimulation with TNFalpha. This indicates that TNFalpha induced de novo synthesis of CXCRII in melanocytes. The here observed effect could be caused either by prolonged stability of the CXCRII mRNA transcripts or by enhanced gene transcription.


In order to evaluate the biological relevance of altered CXCRII expression in melanocytes after TNFalpha treatment, two different proliferation assays were performed. Hereby we could confirm that both chemokines had proliferative activity for melanocytes [13]. In addition, we also saw that TNFalpha alone inhibited constitutive proliferation of melanocytes, as previously published [7]. The underlying mechanisms of this negative effect of TNFalpha on proliferation are currently not understood and could be the consequence of induction of apoptosis in subsets of melanocytes or the consequence of a stop in G0 or G1 phase of the cell cycle. However, addition of CXC-chemokines to TNFalpha-pretreated melanocytes not only reversed the inhibitory effect of TNFalpha, but also provoked a strong proliferation response. In vitro and probably also in vivo melanocytes require synergistic growth factors for proliferation [3]. The best studied combinations in this context are cocktails of fibroblast growth factor, hepatocyte growth factor/scatter factor, mast/stem cell factor, endothelins and melanotropin [3-6]. Data presented here implicate that a sequential application of TNFalpha and CXC-chemokine has a good proliferative activity. Under these circumstances TNFalpha induces expression of the CXCRII in order to sensitise melanocytes for the biological activity towards CXC-chemokines. In this context it might be of interest that TNFalpha and CXC-chemokine are UV-light-inducible genes [25, 26]. Therefore, one could assume that both cytokines, TNFalpha and CXC-chemokines might participate in UV-light-induced proliferation of melanocytes in the skin. Moreover, UV-light is an epidemiological risk factor for melanoma, even though its specific contribution to tumor induction and progression is poorly understood [27]. The first critical step of melanoma development might be disruption of the homeostatic balance of growth and induction of imbalanced proliferation. Based on these in vitro data it might certainly be possible to speculate that interactive mechanism between TNFalpha and CXC-chemokine could contribute to the initiation of malignant melanoma.

Article accepted on 13/01/2003

CONCLUSION

In summary this study revealed that TNFalpha induces expression of CXCRII and magnifies the proliferative activity of CXC-chemokines in melanocytes. The reported interaction between these cytokines might influence the homeostatic growth of melanocytes in the skin.

REFERENCES

De Luca M, Bondanza S, Di Marco E, Marchisio P C, D'Anna F, Franzi AT, Cancedda R. Keratinocyte-melanocyte interactions in vitro reconstituted normal human epidermis In: Leigh IM, Lane B, Watt FM, eds. The Keratinocyte Handbook Cambridge: Cambridge University Press, 1994: 95-104.


Prota G. Melanins, melanogenesis and melanocytes: looking at their functional significance from the chemist's viewpoint. Pigment cell res 2000; 13: 283-93.


Halaban R. The regulation of normal melanocyte proliferation. Pigment cell res 2000; 13: 4-14.


Imokawa G, Kobayasi T, Miyagishi M. Intracellular signaling mechanisms leading to synergistic effects of endothelin-1 and stem cell factor on proliferation of cultured human melanocytes. Cross-talk via trans-activation of the tyrosine kinase c-kit receptor. J Biol Chem 2000; 275: 33321-8.


Suzuki I, Cone RD, Im S et al. Binding of melanotropic hormones to the melanocortin receptor MC1R on human melanocytes stimulates proliferation and melanogenesis. Endocrinology 1996; 137: 1627-33.


Swope VB, Medrano EE, Smalara D, Abdel-Malek ZA. Long-term proliferation of human melanocytes is supported by the physiologic mitogens alpha-melanotropin, endothelin-1, and basic fibroblast growth factor. Exp Cell Res 1995; 217: 453-9.


Krasagakis K, Garbe C, Eberle J, Orfanos CE. Tumor necrosis factor and several interleukins inhibit the growth and modulate the antigen expression of normal human melanocytes in vitro. Arch Dermatol Res 1995; 287: 259-65.


Baggiolini M, Dewald B, Moser B. Interleukin-8 and related chemotactic cytokines - CXC and CC chemokines. Adv Immunol 1993; 55: 97-179.


Richmond A, Balentien E, Thomas et al. Molecular characterization and chromosal mapping of melanoma growth stimulatory activity, a growth factor structurally related to §-thromboglobulin. EMBO J 1988; 7: 2025-33.


Lindley I, Aschauer H, Seifert JM et al. Synthesis and expression in Eschericia coli of the gene encoding monocyte-derived neutrophil activating factor: Biological equivalence between natural and recombinant neutrophil activating factor. Proc Natl Acad Sci U.S.A. 1988; 85: 9199-203.


Richmond A, Thomas HG. Melanoma growth stimulating activity: Isolation from human melanoma tumours and characterisation of tissue distribution. J Cell Biochem 1988; 36: 185-98.


Schršder JM, Peerson NLM, Christophers E. Lipopolysaccharide-stimulated human monocytes secrete, apart from neutrophil-activating peptide 1/interleukin-8, a second neutrophil activating protein. NH2-terminal amino acid sequence identity with melanoma growth stimulatory activity. J Exp Med 1990; 171: 1091-100.


Bordoni R, Fine R, Murray D, Richmond A. Characterization of the role of melanoma growth stimulatory activity (MGSA) in the growth of normal melanocytes, nevocytes, and malignant melanocytes. J Cell Biochem 1990; 44: 207-19.


Murphy PM, Tiffany HL. Cloning of complementary DNA encoding a functional interleukin-8 receptor. Science 1991; 253: 1280-2.


Holmes WE, Lee J, Kuang WJ et al. Structure and expression of a human interleukin-8 receptor. Science 1991; 253: 1278-80.


La Rosa GJ, Thomas KM, Kaufmann ME et al. Amino terminus of the interleukin-8 receptor is a major determinant of receptor subtype specifity. J Biol Chem 1992; 267: 25002-6.



Schraufstätter IU, Barritt DS, Ma M et al. Multiple sites on IL-8 responsible for binding to a and § IL-8 receptors. J Immunol 1993; 151: 6418-28.


Loetscher P, Seitz M, Clark-Lewis I et al. Both interleukin-8 receptors independently mediate chemotaxis. FEBS Lett 1994; 341: 187-92.


Sprenger H, Lloyd AR, Lautens LL et al. Structure, genomic organization, and expression of the human interleukin-8 receptor B gene. J Biol Chem 1994; 269: 11065-72.


Sprenger H, Lloyd AR, Meyer RG et al. Genomic structure, characterization, and identification of the promoter of the human IL-8 receptor A gene. J Immunol 1994; 153: 2524-32.


Bonecchi R, Facchetti F, Dusi S et al. Induction of functional IL-8 receptors by IL-4 and IL-13 in human monocytes. J Immunol 2000; 164: 3862-9.


Norgauer J, Metzner B, Schraufstätter I. Expression and growth-promoting function of the IL-8 receptor in human melanoma cells. J Immunol 1996; 156: 1132-7.


Dichmann S, Rheinen H, Panther E et al. Downregulation of platelet-activating factor responsiveness during maturation of human dendritic cells. J Cell Physiol 2000; 185: 394-400.


Mazzini G, Danova M, Ferrari C et al. Cell proliferation and ploidity of human solid tumors. Methodical experience with the vivo bromodeoxyuridine and DNA flow cytometry. Anal Cell Pathol 1996; 10: 101-13.


Countryman NB, Pei Y, Yi Q et al. Evidence for involvement of the epidermal platelet-activating factor receptor in ultraviolet-B-radiation-induced interleukin-8 production. J Invest Dermatol 2000; 115: 267-72.


Strickland I, Rhodes LE, Flanagan BF, Friedmann PS. TNF-alpha and IL-8 are upregulated in the epidermis of normal human skin after UVB exposure: correlation with neutrophil accumulation and E-selectin expression. J Invest Dermatol 1997; 108: 763-8.


Berking C, Takemoto R, Satyamoorthy K et al. Basic fibroblast growth factor and ultraviolet B transform melanocytes in human skin. Am J Pathol 2001; 158: 943-53.


 

About us - Contact us - Conditions of use - Secure payment
Latest news - Conferences
Copyright © 2007 John Libbey Eurotext - All rights reserved
[ Legal information - Powered by Dolomède ]