Home > Journals > Biology and research > Magnesium Research > Full text
 
      Advanced search    Shopping cart    French version 
 
Latest books
Catalogue/Search
Collections
All journals
Medicine
Biology and research
Magnesium Research
- Current issue
- Archives
- Subscribe
- Order an issue
- More information
Public health
Agronomy and biotech.
My account
Forgotten password?
Online account   activation
Subscribe
Licences IP
- Instructions for use
- Estimate request form
- Licence agreement
Order an issue
Pay-per-view articles
Newsletters
How can I publish?
Journals
Books
Help for advertisers
Foreign rights
Book sales agents



 

Texte intégral de l'article
 
  Printable version
  Version PDF

Splice-variant 1 of the ancient domain protein 2 (ACDP2) complements the magnesium-deficient growth phenotype of Salmonella enterica sv. typhimurium strain MM281


Magnesium Research. Volume 23, Number 2, 105-14, June 2010, original article

DOI : 10.1684/mrh.2010.0206

Summary  

Author(s) : Gerhard Sponder, Sona Svidova, Monika Schweigel, Jürgen Vormann, Martin Kolisek , Max F. Perutz Laboratories, Department of Microbiology, Immunobiology and Genetics, Campus Vienna Biocenter, University of Vienna, Wien, Austria, FBN Dummerstorf, Institute of Nutritional-Physiology, Dummerstorf, Institute of Prevention and Nutrition, Ismaning, Institute of Veterinary-Physiology, Free University Berlin, Berlin, Germany.

Summary : Evidence arguing for the existence of genes encoding for proteins directly involved in the transport of Mg 2+ through the cytoplasmic membrane have accumulated over the last few years. Gene ACDP2 (ancient conserved domain protein 2\; old name CNNM2, cyclin M2) is one such gene. ACDP2 is a distant homologue of the bacterial gene corC, which is known to be involved in cobalt resistance. We have previously demonstrated that the over-expression of the human Mg 2+ carrier SLC41A1 partly complements the Mg 2+-dependent growth deficiency of Salmonella strain MM281 (triple disruptant in genes: mgtA, mgtB and corA) cultivated in media containing growth non-permissive [Mg 2+] e. We have used the same approach to examine whether over-expressed human ACDP2 has a similar efficacy to complement growth deficiency of the MM281 strain in media containing growth non-permissive [Mg 2+] e. Two splicing variants of the ACDP2 gene have been tested. Here, we show that over-expressed isomorph 1 is efficient in restoring growth of the MM281 strain in media containing growth non-permissive [Mg 2+] e, whereas isomorph 2 is not. Therefore, we conclude that ACDP2sp.v.1 is a functional Mg 2+-transporting entity per se. Our conclusion is supported by the measurable Mg 2+ influx seen in MM281 bacteria over-expressing ACDP2sp.v.1 but not in MM281 bacteria over-expressing ACDP2sp.v.2 or in cells transformed with the empty vector.

Keywords : ACDP2, genetic complementation, Salmonella sp., magnesium transporter, mag-fura 2

Pictures

ARTICLE

Auteur(s) : Gerhard Sponder1, Sona Svidova1, Monika Schweigel2, Jürgen Vormann3, Martin Kolisek4

1Max F. Perutz Laboratories, Department of Microbiology, Immunobiology and Genetics, Campus Vienna Biocenter, University of Vienna, Wien, Austria
2FBN Dummerstorf, Institute of Nutritional-Physiology, Dummerstorf
3Institute of Prevention and Nutrition, Ismaning
4Institute of Veterinary-Physiology, Free University Berlin, Berlin, Germany

The importance of magnesium in numerous biological processes is well documented. However, little is known about the magnesium homeostasis of the cell and its transport through the cytoplasmic membrane in particular. This lack of knowledge handicaps the whole process of developing new strategies to diagnose and treat unbalanced magnesium homeostasis, which is often associated with various common ailments or so-called diseases of civilization, at the cellular or organism level.

The genes listed in table 1 have been characterized within the last years as those encoding for proteins that are or might be directly involved in Mg2+ transport processes in eukaryotic cells. One of them is ACDP2, a distant homologue of bacterial CorC, which is assumed to contribute to Mg2+-Co2+ transport/efflux [2-4].
Table 1 Overview of genes encoding for putative or confirmed Mg2+ transporters identified to date.

Gene

Protein

Protein family

Function

Mg2+-regulated expression

Distant bacterial homologue

Reference

SLC41A1

SLC41A1

SLC41

Mg2+ carrier, primary efflux system

Yes

MgtE

[11, 15, 16]

SLC41A2

SLC41A2

SLC41

Mg2+ carrier

Yes

MgtE

[17, 18]

SLC41A3

SLC41A3

SLC41

Putative Mg2+ transporter / homeostatic factor

MgtE

No record

ACDP2

ACDP2 (CNNM2)

ACDP

Mg2+ transporter with channel-like properties, primary influx system

Yes

CorC

[1-4]

MagT1

MagT1

MagT1

Mg2+ transporter with channel-like properties, primary influx system

Yes

______________

[19]

TRPM6

TRPM6

TRPM

Mg2+ chanzyme, primary influx system

Yes

______________

[20]

TRPM7

TRPM7

TRPM

Mg2+ chanzyme, primary influx system

Yes

______________

[21]

NIPA1

NIPA1

NIPA

Mg2+ transporter with channel-like properties, primary influx system

Yes

______________

[22]

NIPA2

NIPA2

NIPA

Mg2+ transporter with channel-like properties, primary influx system

Yes

______________

[23]

N33

N33

N33

Putative Mg2+ transporter / homeostatic factor

Yes

Friederike Ebner and coworkers, unpublished

MMgT1

MMgT1

MMgT

Mg2+ transporter with channel-like properties, Golgi/post-Golgi vesicles

Yes

______________

[24]

MMgT2

MMgT2

MMgT

Mg2+ transporter with channel-like properties, Golgi/post-Golgi vesicles

Yes

______________

[24]

HIP14 HIP14L

HIP14 HIP14L

HIP14

Putative Mg2+ chanzyme, primary influx system

Yes

[25]

hMRS2

hMRS2

CorA-Mrs2-Alr1 superfamily

Mg2+ channel, primary influx system, inner mitochondrial membrane

CorA

[26]

Three splicing variants (sp.v.; figure 1) of ACDP2 have been identified in mammalian cells (NM_017649; variant 1; 4071 bp / 875 aa, NM_199076; variant 2; 4005 bp / 853 aa, NM_199077; variant 3; 2037 bp / 552 aa). According to predictions of SOSUI engine ver. 1.11, ACDP2sp.v.1, 2, and 3 are integral isomorphs having four transmembrane domains (TMs, algorhythm of Mitaku and Hirokawa); however, alternate software (TM-pred, algorhythm of Hofmann and Stoffel) has identified seven TMs in ACDP2 isomorph 1, and 6 TMs in isomorphs 2 and 3. The subcellular localization of full-sized isomorph 1 varies from the nucleus, endoplasmic reticulum and cytoplasm to the cytoplasmic membrane depending on the prediction software (PSORT, WoLF PSORT, HSLpred, BaCelLo, SherLock). However, experimental data of Goytain and Quamme [1] has shown that mouse ACDP2 is targeted to the cytoplasmic membrane when it is expressed in X. laevis oocytes.

Like CorC, ACDP2 contains two tandem repeats of cystathionine beta-synthase (CBS, figure 1) domains [5, 6] (the second CBS domain in ACDP2 is degenerate; NCBI-Structure). These are associated with the C-terminal CorC-HlyC transporter-linked domain (figure 1, ScanProsite). The CBS tandem is found in Na+/H+ antiporters, in proteins involved in Mg2+ and Co2+ transport / homeostasis (e.g. CorC, MgtE) and in some proteins of unknown function (NCBI-Structure). The function of the CorC-HlyC domain is uncertain but it might be involved in modulating the transport of solutes. It is similar to the C-terminal subdomain of the flavin-adenine-dinucleotide- (FAD)-binding domain with transposition of strands 3 and 4 (SCOP database). The CBS domain has been proposed to play a regulatory role [5, 6] and has been shown to be involved in subunit dimerization of soluble guanylyl cyclase [7]. Hattori and coworkers [8] have clearly demonstrated involvement of the CBS domain in the dimerization of the MgtE channel.

Wang and coworkers [3, 4] have found that the ACDP gene family is evolutionarily highly conserved in diverse species ranging from bacteria, yeast, Caenorhabditis elegans and Drosophila melanogaster to mammals. Moreover, they have shown that ACDPs are ubiquitously expressed in various human tissues. This is in agreement with the data of Goytain and Quamme [1] demonstrating the ubiquitous expression of the ACDP2 transcript in various mouse tissues. The findings of both groups thus suggest that ACDP2 plays an important role in basal cell physiology.

In this study, we have identified ACDP2sp.v.1 as being a eukaryotic Mg2+ transporter with the ability to substitute for the genetically distant bacterial Mg2+ transporters CorA, MgtA and MgtB at the functional level in Salmonella strain MM281. Our functional tests with mag-fura2 have also demonstrated that ACDP2sp.v.1 is bona fide inserted in a functional conformation into the cytoplasmic membrane when over-expressed in Salmonella sp.

Materials and methods

Sequences of three human ACDP2 isomorphs are available in the NCBI protein database. Here, we tested isomorphs 1 (875 aa) and 2 (853 aa). Isomorph 3 (552) does not contain a CBS or the CorC-HlyC domain and therefore was excluded from this study.

Cloning of hACDP2; generation of expression constructs

Splicing variant 2 (sp.v. 2) of ACDP2 was isolated by an RT-PCR strategy. Total RNA from CaCo2 cells was isolated with the RNeasy Midi Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. Reverse transcription was carried out with the Revert Aid First Strand cDNA Synthesis Kit (Fermentas, Burlington, ON Canada). The primers ACDP2fw 5’- CAGGTACCATTGGCTGTGGCGCTTGTGAA - 3’ (KpnI restriction site underlined) and ACDP2rev 5’- CCCAAGCTTCTAGTGATGGTGATGGTGATGGATGGCGCCTTCGTTGTGCA-3’ (HindIII restriction site underlined) were used to amplify ACDP2 with a C-terminal 6xHIS tag. The resulting fragment was cloned into the expression vector pQE80L (Qiagen) via the restriction enzymes KpnI and HindIII (both purchased from Fermentas). Sequencing of the construct pQE-ACDP2sp.v.2 (VBC-biotech, Vienna, Austria) revealed a silent mutation at position 1218 (C→T) in the amplified DNA fragment according to the sequence for human ACDP2 syn. CNNM2 (cyclin M2; NM_199076). Transcript variant 1 (NM_017649) could not be isolated by RT-PCR and therefore was generated by digesting pQE-ACDP2sp.v.2 with the restriction enzymes BalI and BglII (both purchased from Promega, Madison, WI USA) subsequently the excised fragment was replaced by a synthetic sequence (Mr. Gene, Regensburg, Germany) corresponding to sp.v.1 of ACDP2. A schematic sequence of the cloning protocol is depicted in figure 2A, B and C.

hACDP2 expression verification; Western analysis

For verification of expression, MM281 cells transformed with pQE-empty and pQE-ACDP2sp.v.1 or pQE-ACDP2sp.v.2 were grown overnight in LB medium supplemented with 10 mM MgCl2. Cells were diluted to an optical density (A600) of 0.8 in pre-warmed LB medium supplemented with 10 mM MgCl2 and incubated for 15 minutes at 37°C. Expression was induced by addition of isopropyl β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.05 mmol.L-1. Aliquots corresponding to 2 ml culture with an A600 of 1 were taken at 30 minutes and 90 minutes after induction of expression. Harvested cells were resuspended in SDS loading buffer. Protein samples were electro-separated on 10% SDS-polyacrylamide gels, blotted on a polyvinylidene difluoride membrane and labelled with Pent-His antibody (Qiagen) and goat anti-mouse secondary antibody (Bio-Rad, Hercules, CA USA).

Description of Salmonella enterica sv. Typhimurium strains; functional complementation tests

Strain MM1927—[mgtB10::MudJ corA45::MudJ mgtA21::MudJ zjh1628::Tn10(cam) ΔleuBCD485 + pMAS29-(corA)]

Strain MM281—[mgtB10::MudJ corA45::MudJ mgtA21::MudJ zjh1628::Tn10(cam) ΔleuBCD485] (Mg2+dependent strain).

Strains MM1927 and MM281 were kindly provided by M. E. Maguire (Case Western Reserve University, Cleveland, USA).

Strain MM281-pQE-ACDP2—[mgtB10::MudJ corA45::MudJ mgtA21::MudJ zjh1628::Tn10(cam) ΔleuBCD485 + pQE-ACDP2sp.v.1 or + pQE-ACDP2sp.v.2.]

Plasmids pQE-empty and pQE-ACDP2sp.v.1 or sp.v.2 were isolated from E. coli and transformed into the Salmonella transmitter strain LT2-LB5010 (strR, r-, m+). MM281 cells with pQE-empty and pQE-ACDP2sp.v.1 or sp.v.2 were cultured in LB medium supplemented with 10 mM MgCl2. For complementation tests, cells from overnight cultures grown in LB with 10 mM MgCl2 were harvested, washed twice in 0.8% saline, adjusted to an A600 of 0.1 and diluted as indicated in figure 3. Serial dilutions were spotted onto LB medium plates containing MgCl2 ([Mg2+]e 0.4 or 10 mmol.L-1) and IPTG ([IPTG]e 0 or 0.05 mmol.L-1) and incubated for 36 hours.

Bacteria inoculated in LB medium (supplemented with [Mg2+]e at 10 mmol.L-1 if necessary) and grown overnight were used for functional complementation tests in liquid cultures. The overnight culture was spun down, washed twice with 0.8% saline and adjusted to an A600 of 0.1 in supplemented N-minimal medium containing [Mg2+]e at 10 mmol.L-1 or 0.4 mmol.L-1 or containing [Mg2+]e at 0.4 mmol.L-1 + [IPTG]e at 0.04 mmol.L-1. A600 was measured every 2 hours within the first 8 hours and after 24 hours. N-minimal medium was prepared according to Nelson and Kennedy [9], except that Na2SO4 was used instead of K2SO4. In addition, the medium was supplemented with 0.1% casamino acids (DIFCO BD, Franklin Lakes, NJ USA) and thiamine (2 mg.L-1, Sigma, St. Louis, MO USA).

Determination of free intracellular Mg2+ by mag-fura 2 fast filter spectrofluorometry

Mag-fura 2 measurements and data analyses were performed according to Froschauer et al. [10] except that the mag-fura 2 AM loading facilitator Pluronic F-127 was used at a final concentration of 5 μmol.L-1 and the mag-fura 2 AM loading period was 30 min. Measurements were taken with a LS-55 spectrofluorometer, operated by FL WinLab software version 4.0 (both products of Perkin-Elmer, Wellesley, MA USA) at 37°C, in 3-mL cuvettes containing the bacterial suspension (2 mL, 3 × 108 bacteria mL-1).

Statistics

All statistical calculations were performed by using Sigma-Stat (Jandel Scientific, San Rafael, CA USA). Significance was determined by Student's t test; p < 0.05 was considered to be significant.

Results

Over-expression of human ACDP2sp.v.1 partly restores growth of the Mg2+-deficient Salmonella strain MM281 in media with otherwise growth non-permissive Mg2+concentrations

The ACDP2 gene shares sequence similarity with the bacterial gene corC [1-4]. CorC is associated with Co2+ resistance in Salmonella. It has been proposed by Wang and co-workers [3, 4] and Goytain and Quamme [1] that ACDP2 functions as an X2+ transporter in mammalian cells.

The three major Mg2+ influx systems of Salmonella sp., genes corA, mgtA and mgtB, are disrupted in strain MM281. In contrast to wild type strains that can grow at [Mg2+]e of 10-100 μmol.L-1, this strain requires [Mg2+]e from 10 to 100 mmol.L-1 to proliferate [11, 12].

We tested the ability of human ACDP2 isomorph 1 and isomorph 2 to complement the Mg2+-dependent growth-deficient phenotype of strain MM281 by transforming it with plasmids pQE-ACDP2sp.v.1, pQE-ACDP2sp.v.2 or pQE-empty. The expression of N-terminal His-tagged ACDP2sp.v.1 and ACDP2sp.v.2 after addition of IPTG (0.04 mmol.L-1) was confirmed by Western blot analysis of the total protein isolate (figure 2D). Growth curves were established within 24 h for strains MM281-pQE-empty, MM281-pQE-ACDP2sp.v.1, MM281-pQE-ACDP2sp.v.2, and MM1927 (control strain) in media containing 400 μmol.L-1 or 10 mmol.L-1 Mg2+ or containing 400 μmol.L-1 Mg2+ + 0.04 mmol.L-1 IPTG. No difference was observed among the growth rates of all four tested strains after a 24-hour incubation in medium containing 10 mmol.L-1 Mg2+ (figure 3A). The initial decrease in the growth rate of strains MM281-pQE-ACDP2sp.v.1 and MM281-pQE-ACDP2sp.v.2 might have been caused by the leaky (below Western blot detection limit) expression of both isomorphs of ACDP2 and consequently by their mild cytotoxicity or simply by the presence of pQE-ACDP2sp.v.1 and pQE-ACDP2sp.v.2 constructs in the cells. When cultivated at an [Mg2+]e of 400 μmol.L-1 without addition of IPTG (figure 3B), MM281 bacteria expressing ACDP2 isomorphs 1 and 2 remained growth-arrested, similar to MM281-pQE-empty, the negative control. As expected, strain MM1927 grew normally and no significant difference was detected between the growth rates of this strain in medium supplemented with 10 mmol.L-1 Mg2+ or with 400 μmol.L-1 Mg2+. The growth maximum of strain MM281-pQE-ACDP2sp.v.1 reached 34% of the growth maximum of control strain MM1927 when cultivated for 24 hours at an [Mg2+]e of 400 μmol.l-1 and supplementation with IPTG figure 3C), whereas strain MM281-pQE-ACDP2sp.v.2 and MM281-pQE-empty remained growth-arrested (figure 3C). As shown in figure 3, the growth of the plated serial dilutions seen after 24 hours of incubation at 37°C clearly corresponded to the respective sets of the growth curves. Moreover, the growth of the serial dilutions of strain MM281-pQE-ACDP2sp.v.1 and of strain MM281-pQE-hSLC41A1 [12] (positive control) were comparable when they were cultivated on N-minimal medium supplemented with 400 μmol.L-1 MgCl2 and 0.05 mmol.L-1 IPTG. The expression of ACDP2sp.v.2 did not rescue the growth of MM281 strain under these conditions.

Characterization of ACDP2sp.v.1 and ACDP2sp.v.2 Mg2+-transport abilities in Salmonella sp. by use of mag-fura 2

Measurements of the [Mg2+]i of bacteria from strains MM1927, MM281-pQE-empty, MM281-pQE-ACDP2sp.v.1 and MM281-pQE-ACDP2sp.v.2 were performed by using mag-fura 2 fast filter spectroscopy [10, 12]. Mg2+-starved bacteria were incubated in Mg2+-free 0.9% saline and the basal [Mg2+]i were determined. Mg2+ was successively added to give a final concentration of 10 mmol.l-1 and the [Mg2+]i was determined after 20 minutes. The results are summarized in table 2. The basal [Mg2+]i measured in Mg2+-free solution was 0.63 ± 0.08, 0.66 ± 0.11, 0.68 ± 0.04 and 0.66 ± 0.05 mmol.L-1 in MM1927, MM281-pQE-empty, MM281-pQE-ACDP2sp.v.1 and MM281-pQE-ACDP2sp.v.2 bacteria, respectively. In MM1927 and MM281-pQE-ACDP2sp.v.1 bacteria, a 123.8% and 50% increase of [Mg2+]i was observed at 20 minutes after increasing the [Mg2+] of the external solution to 10 mmol.L-1. In contrast, no change of [Mg2+]i was measured in strain MM281-pQE-empty. Bacteria expressing ACDP2sp.v.2 increased their [Mg2+]i by 12.1% in the presence of [Mg2+]e at 10 mmol.L-1 after 20 minutes. However, this [Mg2+]i increase could not be considered significant when it was related to data obtained with control strain MM281-pQE-empty.
Table 2 Mag-fura 2 [Mg2+]i measurements.

[Mg2+]e

MM1927

MM281+pQE-empty

MM281+pQE-ACDP2sp.v.1

MM281+pQE-ACDP2sp.v.2

0

0.63 ± 0.08

0.66 ± 0.11

0.68 ± 0.04

0.66 ± 0.05

10

1.41 ± 0.12

0.64 ± 0.09

1.02 ± 0.10

0.74 ± 0.09

Discussion

The Mg2+-dependent growth-deficient Salmonella strain MM281 has previously been used by our group and by others for testing the ability of the various prokaryotic and eukaryotic candidate Mg2+ transporters to restore its growth and thus to demonstrate the physical involvement of these proteins in Mg2+ transport [10, 11, 13, 14]. ACDP2 has been identified exclusively in the genomes of eukaryotes [3, 4]; however, because of its distant homology to bacterial corC, we have considered that it might be functional in Salmonella sp. and possibly able to complement the Mg2+-dependent growth defect of the MM281 strain.

Gibson and coworkers [2] have shown that mutation of corC alters the Mg2+ sensitivity of CorA efflux but not the influx of Mg2+. Therefore a possible interpretation is that a CorC:CorA complex mediates Mg2+ efflux, but this however has not been shown as yet.

CorC contains the CBS tandem, as ACDP2 isomorphs 1 and 2 do, although the second CBS domain is degenerated in both ACDP2 isomorphs. This domain has been found in prokaryotic and eukaryotic transporters mediating the transport of various ions and was demonstrated to be a dimerization domain ([5-8], NCBI-Structure). Hence the presence of a CBS domain suggests that both isomorphs of ACDP2 form homo- or hetero-dimers or more complex oligomers.

Moreover, the C-terminally located CorC-HlyC (hemolysin C) domain is associated with the CBS tandem in ACDP2sp.v.1 and sp.v.2 (NCBI-Structure, SCOP database). Our data demonstrate that the sequential ancestry of ACDP2 with CorC can be established by a simple genetic (functional) complementation test.

ACDP2sp.v.1, when over-expressed from pQE-ACDP2sp.v.1 in the MM281 strain partly restores the growth of this triple disruptant in low Mg2+ liquid media and also when plated on low Mg2+ solid N-minimal medium. However, the growth-promoting effect of ACDP2sp.v.2 in this strain is insignificant.

The sequence analysis has shown that the difference between the full-sized ACDP2sp.v.1 and the shorter sp.v.2 is the 22-aa-long deletion (at position 722 to 743 of isomorph 1; see supplementary material on line). ClustalW2 multiple alignment of CorC (Salmonella enterica sv. Heidelberg), of the CorC-HlyC domain (Chlorobium tepidum) and of both tested human ACDP2 isomorphs (supplementary material on line) has revealed that the 22-aa-sequence crucial for Mg2+ influx is located upstream from the ACDP2 regions corresponding to the CBS tandem or CorC-HlyC domain. This region might thus be important for the proper assembly of the Mg2+-binding site or for Mg2+-binding per se. Because the CBS tandem and CorC-HlyC domain is also present in ACDP2sp.v.2, the second isomorph is probably also a functional transporter, however with affinity to ion(s) other than Mg2+. This is in agreement with the rather heterogeneous permeation profile established for ACDP2 by Goytain and Quamme [1]. However, stereochemical heterogeneity of the hydrated cations permeated by ACDP2 in the experimental setting of Goytain and Quamme [1] is controversial from the standpoints of theoretical stereochemistry and structural transport biology.

Despite being a distant homologue of CorC (component of the assumed CorA:CorC bacterial Mg2+ efflux system), ACDP2sp.v.1 mediates Mg2+ influx, as demonstrated by our complementation tests in Salmonella strain MM281. ACDP2sp.v.2 is not able to mediate Mg2+ influx in strain MM281 at a growth-limiting Mg2+ concentration in the medium. However, at this point we cannot rule out that the shorter isomorph 2 is responsible for Mg2+ efflux and the longer isomorph 1 for Mg2+ influx. The “efflux/influx switch domain” hypothesis would explain the behaviour of both isomorphs in complementation tests and also correlates with the finding that both isomorphs contain the sequentially identical CBS tandem and CorC-HlyC domain (both assumed to be involved in Mg2+ recognition and binding; both localized downstream from the missing sequence /722-PVPLSLSRTFVVSRTELLAAGS-743; ACDP2sp.v.1/ in ACDP2sp.v.2; see supplementary material on line).

In conclusion, our results show that:

  •  human ACDP2 isomorph 1 is a Mg2+ transporter capable of partial functional substitution for CorA, MgtA and MgtB Mg2+ transport systems in Salmonella strain MM281;
  •  isomorph 2 lacks this capability;
  •  the region between amino acids 722 and 743 of isomorph 1, which is not present in isomorph 2, seems to be important either for Mg2+ binding, Mg2+-binding-site assembly or discrimination between the influx and efflux operation mode of the ACDP2 transporter;
  •  ACDP2sp.v.1 mediates mag-fura 2 detectable Mg2+ influx at large inward-oriented Mg2+ gradients.

Acknowledgments

Our gratitude is due to Katharina Wolf, Uwe Tietjen (both FU Berlin) and Mirjana Iljev (MFPL Vienna) for excellent technical support of this project. We also thank Prof. Holger Martens (FU Berlin) and Prof. Rudolf J. Schweyen (in memoriam; MFPL Vienna) for helpful advise, to Prof. Michael E. Maguire (Case Western University Ohio) for providing us with Salmonella enterica strains MM1927 and MM281 and to Dr. Theresa Jones for linguistic corrections.

Financial support and disclosure

This work was supported by a research grant from the German Research Foundation (DFG), KO-3586/3-1 to MK.

None of the authors has any conflict of interest to disclose.

References

1 Goytain A, Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a divalent metal transporter. Physiol Genomics 2005; 22: 382-9.

2 Gibson MM, Bagga DA, Miller CG, Maguire ME. Magnesium transport in Salmonella typhimurium: the influence of new mutations conferring Co2+ resistance on the CorA Mg2+ transport system. Mol Microbiol 1991; 5: 2753-62.

3 Wang CY, Yang P, Shi JD, Purohit S, Guo D, An H, Gu JG, Ling J, Dong Z, She JX. Molecular cloning and characterization of the mouse Acdp gene family. BMC Genomics 2004; 5: 7.

4 Wang CY, Shi JD, Yang P, Kumar PG, Li QZ, Run QG, Su YC, Scott HS, Kao KJ, She JX. Molecular cloning and characterization of a novel gene family of four ancient conserved domain proteins (ACDP). Gene 2003; 306: 37-44.

5 Bateman A. The structure of a domain common to archebacteria and the homocystinuria disease protein. Trends Biochem Sci 1997; 22: 12-3.

6 Ponting CP. CBS domains in ClC chloride channels implicated in myotonia and nephrolithiasis (kidney stones). J Mol Med 1997; 75: 160-3.

7 Zhou Z, Gross S, Roussos C, Meurer S, Müller-Esterl W. Structural and Functional Characterization of the Dimerization Region of Soluble Guanylyl Cyclase. J Bioll Chem 2004; 279: 24935-43.

8 Hattori M, Iwase N, Furuya N, Tanaka Y, Tsukazaki T, Ishitani R, Maguire ME, Ito K, Maturana A, Nureki O. Mg2+-dependent gating of bacterial MgtE channel underlies Mg2+ homeostasis. Embo J 2009; 28: 3602-12.

9 Nelson DL, Kennedy EP. Magnesium transport in Escherichia coli, inhibition by cobaltous Ion. J Biol Chem 1971; 246: 3042-9.

10 Froschauer EM, Kolisek M, Dietrich F, Schweigel M, Schweyen RJ. Fluorescence measurements of free [Mg2+] by use of mag-fura 2 in Salmonella enterica. FEMS Microbiol Lett 2004; 237: 49-55.

11 Smith RL, Thompson LJ, Maguire ME. Cloning and characterization of MgtE, a putative new class of Mg2+ transporter from Bacillus firmus OF4. J Bacteriol 1995; 177: 1233-8.

12 Kolisek M, Launay P, Beck A, Sponder G, Serafini N, Brenkus M, Froschauer EM, Martens H, Fleig A, Schweigel M. SLC41A1 is a novel mammalian Mg2+ carrier. J Biol Chem 2008; 283: 16235-47.

13 Hmiel SP, Snavely MD, Florer JB, Maguire ME, Miller CG. Magnesium transport in Salmonella typhimurium: genetic characterization and cloning of three magnesium transport loci. J Bacteriol 1989; 171: 4742-51.

14 Smith RL, Gottlieb E, Kucharski LM, Maguire ME. Functional Similarity between Archaeal and Bacterial CorA Magnesium Transporters. J Bacteriol 1998; 180: 2788-91.

15 Wabbaken T, Rian E, Kveine M, Aasheim HC. The human solute carrier SLC41A1 belongs to a novel eukaryotic subfamily with homology to prokaryotic MgtE Mg2+ transporters. Biochem Biophys Res Commun 2003; 306: 718-24.

16 Goytain A, Quamme GA. Functional characterization of human SLC41A1, a Mg2+ transporter similar to prokaryotic MgtE Mg2+ transporters. Physiol Genomics 2005; 21: 337-42.

17 Goytain A, Quamme GA. Functional characterization of the mouse solute carrier, SLC41A2. Biochem Biophys Res Commun 2005; 330: 701-5.

18 Sahni J, Nelson B, Scharenberg AM. SLC41A2 encodes a plasma-membrane Mg2+ transporter. Biochem J 2007; 401: 505-13.

19 Goytain A, Quamme GA. Identification and characterization of a novel mammalian Mg2+ transporter with channel like properties. BMC Genomics 2005; 6: 48.

20 Groenestege WM, Hoenderop JG, van den Heuvel L, Knoers N, Bindels RJ. The epithelial Mg2+ channel transient receptor potential melastatin 6 is regulated by dietary Mg2+ content and estrogens. J Am Soc Nephrol 2006; 17: 1035-43.

21 Schmitz C, Perraud AL, Johnson CO, Inabe K, Smith MK, Penner R, Kurosaki T, Fleig A, Scharenberg AM. Regulation of vertebrate cellular Mg2+ homeostasis by TRPM7. Cell 2003; 114: 191-200.

22 Goytain A, Hines RM, El-Husseini A, Quamme GA. NIPA1(SPG6), the basis for autosomal dominant form of hereditary spastic paraplegia, encodes a functional Mg2+ transporter. J Biol Chem 2007; 282: 8060-8.

23 Goytain A, El-Husseini A, Quamme GA. Functional characterization of NIPA2, a selective Mg2+ transporter. Am J Physiol Cell Physiol 2008; 295: 944-53.

24 Goytain A, Quamme GA. Identification and characterization of a novel family of membrane magnesium transporters, MMgT1 and MMgT2. Am J Physiol Cell Physiol 2008; 294: 495-502.

25 Goytain A, Hines RM, Quamme GA. Huntingtin-interacting proteins, HIP14 and HIP14L, mediate dual functions, palmitoyl acyltransferase and Mg2+ transport. J Biol Chem 2008; 283: 33365-74.

26 Piskacek M, Zotova L, Zsurka G, Schweyen RJ. Conditional knockdown of hMRS2 results in loss of mitochondrial Mg2+ uptake and cell death. J Cell Mol Med 2009; 13: 693-700.


 

About us - Contact us - Conditions of use - Secure payment
Latest news - Conferences
Copyright © 2007 John Libbey Eurotext - All rights reserved
[ Legal information - Powered by Dolomède ]