ARTICLE
Auteur(s) : Qingxia Yao, Ping Qian, Yi Cao, Yannan He,
Youhui Si, Zhuofei Xu, Huanchun Chen
Laboratory of Animal Virology, College of Veterinary Medicine,
Unit of Animal Infectious Diseases, National Key Laboratory of
Agricultural Microbiology, Huazhong Agricultural University, Wuhan,
Hubei Province, People’s Republic of China
accepté le 4 Juin 2007
Pseudorabies virus (PRV) is a porcine alpha herpes virus related to
the human pathogens Herpes simplex virus type 1 (HSV-1), HSV-2, and
Varicella zoster virus [1]. It causes severe disease in piglets and
leads to latent infection in all surviving pigs. PRV infection
inflicts serious losses on the swine industry worldwide [2].The PRV
genome is a linear, duplex DNA molecule coding for three classes of
genes: immediate-early (IE), early, and late genes [3]. The IE
genes are transcribed immediately upon infection and do not require
de novo protein synthesis. Transcription of early genes depends on
IE protein expression and occurs before viral DNA replication. The
late genes are transcribed after the onset of viral protein and DNA
synthesis. Thus, the IE gene (IE180) of PRV functions to allow
continuous transcription of late genes and shuts off the synthesis
of its own RNA [4], which indicates that the IE gene is necessary
for productive lytic infection.The interferon (IFN) system has
become recognized as a major natural defense mechanism against
viral disease [5-8]. Most species have three IFNs: IFN-α and IFN-β
belong to type I IFN, and IFN-γ belongs to type II IFN. The three
IFNs are important components of the host immune response to viral
infections. Recent reports have indicated that IFNs used in
combination have synergistic antiviral activity against HSV-1 [9],
HCV [10], severe acute respiratory syndrome-associated coronavirus
(SARS-CoV) [11], Lassa virus [12] and HCMV [13]. Although it has
been found that IFN-α/β/γ have anti-PRV activity [14-16], little is
known about the anti-PRV activities of the different IFNs, or a
combination of the specific porcine IFNs, on porcine cells. The
objective of this study was to compare the sensitivity of PRV to
the antiviral effects of porcine IFN-α (PoIFN-α), PoIFN-β, PoIFN-γ,
and a combination of type I PoIFN and type II PoIFN in vitro.
Methods
Cells, virus and interferons
IBRS-2 cells (porcine kidney cells) and MDBK cells (Madin-Darby
bovine kidney cells) were provided by the China Institute of
Veterinary Drug Control and grown in Dulbecco’s Modified Eagle
Media (DMEM, Life Technologies Inc., Grand Island, NY, USA)
supplemented with 10% heat-inactivated fetal bovine serum (Life
Technologies Inc), 100 μg of streptomycin/mL, and 100 IU of
penicillin/mL. All the cell lines were free of BVDV, which was
monitored by the BVDV-specific primers.
The pseudorabies virus (PRV) stock (strain Ea) contained
1.2 × 108/ml PFU as titrated in IBRS-2 cells.
This virus was stored in our laboratory [17]. PoIFN-α, PoIFN-β and
PoIFN-γ were prepared by our laboratory. The full-length genes,
including the signal peptides of PoIFN-α, PoIFN-β and PoIFN-γ, were
cloned from spleen cells or peripheral blood lymphocytes of the
Chinese local breed of pig, Meishan porcine. A 3’ nine-His tag was
added by PCR, and the DNAs of PoIFN-α, PoIFN-β and PoIFN-γ were
individually subcloned into the eukaryotic expression vector
pcDNA3.1(+). Proteins of PoIFN-α, PoIFN-β and PoIFN-γ were produced
by IBRS-2 cells transfected with pcD-PoIFNα, pcD-PoIFNβ, and
pcD-PoIFNγ. The proteins were then purified on a
Ni-nitrilotriacetic acid agarose column (Qiagen, Hilden, Germany).
The purified PoIFN-α, PoIFN-β and PoIFN-γ were found to be 98%, 96%
and 95% pure, respectively. The values in international units (IU),
were determined by anti-vesicular stomatitis virus (VSV) titers in
MDBK cells. The supernatant from IBRS-2 cells transfected with the
pcDNA plasmid had no antiviral activity. A reference standard of
PoIFN-α (PBL InterferonSource) was also 2-fold diluted, with an
initial concentration of 160 U/mL. Concentrations of 100 IU/mL
of each IFN were used in all experiments unless stated
otherwise.
Plaque reduction and viral replication assays
For plaque reduction assays, IBRS-2 cells were seeded in 6-well
plates at a density of 1.0 × 106 cells per
well, and 12 h later different PoIFNs were added to the
culture medium. IBRS-2 cells were inoculated with PRV 18 h
later, and 1 h later the medium was replaced with complete
DMEM containing 0.8% LWA (aMReSCO) and the respective PoIFN(s) was
added to the cells. Plaques were counted two to three days later.
For viral replication assays, vehicle- and PoIFN-treated IBRS-2
cells were infected with PRV at a multiplicity of infection (MOI)
of 0.1. After 1 h adsorption, the inoculum was removed, the
monolayers were washed twice with 1×PBS, and fresh PoIFN-containing
medium was returned to each well. The cultures were freeze–thawed
24 h after infection, and the viral titer was determined on
IBRS-2 cells [9].
Viral entry assay
Vehicle- and PoIFN-treated IBRS-2 cells were inoculated with PRV at
MOIs of 0.1, 0.2, 0.3, 0.6, 1.2, 2.5, 5, 10, and 20. After 1 h
adsorption, the inoculi were removed. The cells were washed twice
with 1×PBS and subsequently treated with 0.05% trypsin for five
minutes to ensure elimination of virus particles that had adhered
to but had not penetrated the cells [18-20]. Cells were pelleted
and washed twice with 1x PBS to remove trypsin and non-adherent
virus. DNA was isolated from each sample by a standard
phenol:chloroform DNA extraction procedure [21], and PRV-specific
oligonucleotide primers were used to amplify a 146 bp product
corresponding to the partial PRV IE180 gene, as described
previously [22]. PCR products were resolved in a 2% agarose gel and
imaged using an Alpha Innotech gel documentation system (Alpha
Innotech, Corp., San Leandro, CA, USA).
Real-time PCR
Vehicle- and PoIFN-treated IBRS-2 cells were infected with PRV at a
MOI of 0.1. At 24 h p.i., total RNA was prepared using a
RNeasy Mini Prep kit (Qiagen, Inc., Valencia, CA, USA) according to
the manufacturer’s instructions. Samples were treated with DNase I
(Promega GmbH, Mannheim, Germany), RNA concentration and purity
were determined spectrophotometrically (A260/A280), and 250 ng were
reverse transcribed in a total volume of 20 μL using the ReverTra
Ace (Toyobo Co. Ltd., Osaka, Japan), according to the
manufacturer’s instructions. For real-time PCR, 1 μL of cDNA was
amplified in SYBR Green Realtion PCR Master Mix (Toyobo Co. Ltd.,
Osaka, Japan) containing specific primer pairs. The optimal primer
concentrations and sequences were as follows: 200 nM IE180, sense
5′ AGACCGAGGGCAACTTCAGC 3′, antisense 5′ GGGGCCAAAGAGGAGATCC 3′;
200 nM GAPDH, sense 5′GTCAAGCTCATTTCCTGGTA 3′, antisense 5′
AAACTGGAAGTCAGGAGATG 3′. All samples were run on the same plate;
those for the reference gene (GAPDH) and those for the genes of
interest were each run in triplicate in independent wells for each
of three independent RNA preparations. PCR parameters were as
follows: an initial step to denature at 95°C for 2 minutes followed
by 40 cycles at 95°C for 30 seconds, annealing at 55°C for 30
seconds and extension at 72°C for 45 seconds. The threshold cycles
(CT), at which an increase in reporter fluorescence above the
baseline signal could first be detected, were determined. Relative
quantification of the target genes in comparison to the GAPDH
reference gene was determined by calculating the relative
expression ratio (R) of each target gene as follows: R =
(Etarget)ΔCT(vehicle-sample)/(EGAPDH)ΔCT(vehicle-sample)[23].
Differences in gene expression between the PoIFN-treated cells and
the vehicle-treated control cells were expressed as x-fold
inhibition.
Statistical analysis
Statistical analysis of the data was carried out using one-way
analysis of variance (ANOVA) and Tukey’s post hoc t-test using SPSS
software.
Results
PoIFN-α/β, PoIFN-γ and a combination inhibit PRV plaque
formation
The abilities of PoIFN-α, PoIFN-β, and PoIFN-γ to inhibit the
replication of PRV were initially compared in a plaque reduction
assay on IBRS-2 cells. Viral plaque formation was reduced 1.26-,
5.3- or 3.3-fold in IBRS-2 cells treated with 100 IU/mL of PoIFN-α,
PoIFN-β, or PoIFN-γ, respectively (table
1). To test the effects of combined PoIFN-treatments on
viral plaque formation, IBRS-2 cells were pre-treated with 100
IU/mL each of (1) PoIFN-α and PoIFN-β, (2) PoIFN-α and PoIFN-γ or
(3) PoIFN-β and PoIFN-γ. As expected, the level of inhibition
achieved with both PoIFN-α and PoIFN-β was not greater than the
level of inhibition achieved by both PoIFNs separately. In
contrast, pre-treatment with both type I (PoIFN-α or PoIFN-β) and
type II IFN (PoIFN-γ) reduced PRV plaque formation efficiency 12.8-
and 100-fold, respectively (table 1). To
eliminate the possibility that this effect was merely a result of
doubling the total amount of PoIFNs per culture, we tested the
inhibitory effects of 200 IU/mL of each PoIFN separately. Two
hundred IU/mL of PoIFN-α, PoIFN-β or PoIFN-γ reduced PRV plaque
formation 1.34-, 6.5- or 5.8-fold, respectively (table 1). Of the three PoIFNs, PoIFN-α gave the
least inhibition of the PRV plaque formation. To further evaluate
the effects of dose, variable concentrations of PoIFN-α were used.
With a pretreatment of 12800 IU/mL of PoIFN-α, the reduction in
plaque formation was 2.3-fold (figure 1).
Table 1 PoIFN-α, PoIFN-β and PoIFN-γ inhibit PRV plaque
formation in IBRS-2 cells
|
Treatment (IU/mL)a
|
Mean no. of plaquesb ± SEM
|
x-fold reductionc
|
|
Vehicle
|
200 ± 0.9
|
|
|
PoIFN-α (100)
|
167 ± 2.5*
|
1.26
|
|
PoIFN-β (100)
|
38 ± 1.1*
|
5.3
|
|
PoIFN-γ (100)
|
61 ± 0.9*
|
3.3
|
|
PoIFN-α (100) + PoIFN-β (100)
|
40 ± 1.3*
|
5.0
|
|
PoIFN-α (100) + PoIFN-γ (100)
|
17 ± 0.6*d
|
12.8
|
|
PoIFN-β (100) + PoIFN-γ (100)
|
2 ± 0.4*
|
100
|
|
PoIFN-α (200)
|
154 ± 3.0*
|
1.34
|
|
PoIFN-β (200)
|
31 ± 0.6*
|
6.5
|
|
PoIFN-γ (200)
|
34 ± 0.8*
|
5.8
|
aIBRS-2 cells were treated continuously with PoIFN-α,
PoIFN-β, PoIFN-γ, or combinations of these cytokines, from
18 h before infection until the end of the experiment.
bThe number of plaques formed in IBRS-2 cells
inoculated with 200 PFU of PRV strain Ea (n = 4 per
group). * p<0.05, as determined by one-way ANOVA and Tukey’s
post hoc t-test comparison of this treatment to vehicle.
cThe x-fold reduction in each group was calculated as
follows: number of plaques in vehicle/number of plaques in
treatment.
dBoldface type indicates a >10-fold reduction in
PRV plaque formation.
PoIFN-α/β and PoIFN-γ synergize to inhibit PRV replication in
IBRS-2 cells
PRV replication was compared in IBRS-2 cells treated with vehicle,
PoIFN-α, PoIFN-β, PoIFN-γ or both PoIFN-α and PoIFN-γ or both
PoIFN-β and PoIFN-γ.
In vehicle-treated cultures, PRV strain Ea replicated to a titer
of 7 × 107 PFU/mL over a 24-h period of
incubation (figure
2). PRV replicated to titers of
6.8 × 107, 4.4 × 106, and
6.4 × 107 PFU/mL in cultures treated with 100
IU of PoIFN-α, PoIFN-β, or PoIFN-γ/mL, respectively (figure 2). Treatment with
PoIFN-β alone significantly reduced PRV replication by 16-fold
(p < 0.05, figure 2). In cultures
treated with both PoIFN-α/β and PoIFN-γ, PRV replicated to titers
of
2.4 × 106 – 4.8 × 105
PFU/mL and was significantly inhibited, by 29- or 146-fold,
relative to vehicle-treated cultures. This effect was far greater
than a possible additive effect, and indicated synergistic
inhibition (p < 0.05, figure 2).
Treatment with PoIFN-α/β and PoIFN-γ does not inhibit PRV
adsorption to IBRS-2 cells
The PRV replication cycle is a multi-step process, beginning with
viral attachment and entry into the host target cell. To
investigate the mechanisms by which PoIFN-α/β and PoIFN-γ inhibit
PRV replication, we first examined the effect of PoIFNs on PRV
entry into IBRS-2 cells. Cells were treated with vehicle or PoIFNs
for 18 hours (h) prior to infection with PRV. One h after viral
adsorption, DNA was isolated from the PRV-infected cells and PCR
was used to amplify a 146 bp fragment of the partial PRV IE180 gene
(figure 3). For
each treatment group, the PCR product yield increased as a function
of viral multiplicity of infection (MOI). At all MOIs tested, the
amount of PCR product amplified from IBRS-2 cells treated with
PoIFNs was comparable to that of vehicle treated IBRS-2 (figure 3).
Co-amplification of a GAPDH 207 bp PCR product served as an
internal loading control for normalization of PCR product between
treatment groups (data not shown). The amplification of similar
levels of PCR products from IBRS-2 cells suggests that the
inhibitory effect of PoIFN-α/β and PoIFN-γ does not occur at the
level of viral adsorption.
PoIFN-α/β and PoIFN-γ inhibit PRV IE mRNA expression
IE protein expression plays a pivotal role in controlling
subsequent viral and cellular gene expression during productive PRV
infection [24], such that an inhibitory effect at this level
significantly impairs viral replication. It has been demonstrated
that PRV replication in Vero cells is suppressed by treatment with
human, natural IFN-α. In addition, messenger RNA transcribed from
the PRV IE gene is reduced in IFN-alpha-treated cells [15].
However, the mechanisms of the antiviral activities of PoIFNs
against PRV are still unclear. To assess the effect of PoIFN
treatment on IE180 gene expression, real-time PCR analyses of IE180
mRNA levels in PoIFN-treated cells were performed. Figure 4 summarizes the
repression in IE180 mRNA levels in PoIFN-treated cultures compared
with vehicle-treated controls. At 24 h p.i., statistically
significant differences were found in IE180 mRNA levels between
treated and non-treated cells (data not shown). In addition, mRNA
levels in IBRS-2 cells pretreated individually with either PoIFN-α,
PoIFN-β, or PoIFN-γ were inhibited < 20-fold, whereas in
cells pretreated with both PoIFN-α and PoIFN-γ, IE180 mRNA
expression was inhibited 23.8-fold. A more enhanced inhibitory
effect was observed in IBRS-2 cells treated with both PoIFN-β and
PoIFN-γ. In these cultures, IE180 mRNA expression was repressed
133-fold (figure
4).
Interestingly, the degree of IE mRNA inhibition observed in
IBRS-2 cells treated with PoIFN-γ plus PoIFN-β was greater than
that observed in cultures treated with PoIFN-γ plus PoIFN-α,
suggesting that type II IFN-mediated inhibition of IE mRNA
expression is better facilitated by treatment with PoIFN-β than
PoIFN-α.
Discussion
The immune response of the host is responsible for preventing viral
dissemination and replication following viral infection. As part of
the non-specific immune response, type I IFNs are secreted by
infected cells and function to induce an antiviral state in
neighboring, uninfected cells. Type I IFNs also contribute to the
overall antiviral response by stimulation of infiltrating immune
cells, such as natural killer (NK) cells and macrophages, to
secrete numerous chemokines and cytokines. With the activation of
the specific immune response, T-cells can further add to the milieu
of immune cytokines present at the site of viral infection by
secreting additional cytokines, including IFN-γ [13]. Thus, both
type I and type II IFNs are important for the antiviral defenses of
the host. Because the proteins used in this study were purified and
the supernatant of IBRS-2 transfected with the pcDNA3.1(+) plasmid
had no anti-VSV activity, the antiviral activities of the proteins
were induced by PoIFNs and not by other biologically active
molecules.
Because pigs are the natural host of PRV, it is necessary to
investigate the antiviral effects of porcine IFNs in porcine cell
lines. The results of the plaque formation and viral replication
assays established that PoIFN-β had the highest potency of the
three PoIFNs to inhibit PRV in vitro, which is consistent with the
results of inhibition of IE180 mRNA. Type I IFNs (IFN-α and IFN-β)
and type II IFN (IFN-γ) activating distinct but related Jak/STAT
signal cascades resulting in the transcription of several hundred
IFN-stimulated genes [25]. Although similar genes are activated by
all three IFNs, Der et al. [26] have identified numerous genes
differentially regulated by IFN-α, IFN-β or IFN-γ. In particular,
IFN-β stimulation induces twice as many genes as IFN-α. This
differential regulation of IFN-induced genes may partially explain
the fact that the level of inhibition observed in IBRS-2 cells
treated with PoIFN-β was consistently greater than that observed in
cells treated with PoIFN-α, although both PoIFN-α and PoIFN-β bind
to the same receptor.
It has previously been demonstrated that treatment of cells with
both IFN-α and IFN-β potently inhibits PRV replication [15, 16];
however, these studies did not determine whether the effect was
synergistic or identify the mechanism of inhibition. Recent studies
have shown that type I and type II IFNs function, in synergy, to
inhibit both RNA and DNA viruses, including HCV [10], HSV-1 [9],
SARS-CoV [11], Lassa virus [12] and HCMV [13]. The results
presented here are consistent with this hypothesis.
The inhibitory effect of PoIFN-α/β and PoIFN-γ was synergistic,
and the degree of inhibition was not matched by increasing the
concentrations of each individual PoIFN. These results indicate
that the observed PoIFN-induced antiviral effects were a direct
result of the presence of two distinct types of PoIFN. The
mechanism(s) by which PRV replication is inhibited remain unclear.
Type I and type II IFNs may act synergistically by acting on one or
more different stages of the PRV lytic cycle, such as (1) viral
attachment, (2) viral entry, (3) IE gene expression, (4) early gene
expression, (5) DNA replication, (6) late gene expression, (7)
virus assembly, or (8) viral egress and maturation. To address the
question of attachment and entry, PCR was used to amplify viral DNA
from IFN-treated and vehicle-treated cultures shortly after
infection. Consistent with earlier observations [9, 13], PoIFN
treatment did not prevent viral entry into cells, as indicated by
equal PCR product yields from all treatment groups. These data
indicate that PoIFNs exert their inhibitory effects at a step after
viral attachment and entry.
The PRV genome expresses a single, immediate-early (IE) protein
species from two copies of the IE gene that are present in each
inverted repeat region of the viral genome [15]. The product of the
PRV IE gene, IE180, functions to allow continuous transcription of
late genes and shuts off the synthesis of its own RNA [27]. Using
real-time PCR, we showed that while PoIFN-α, PoIFN-β, or PoIFN-γ
treatment inhibited IE mRNA expression 7.3- to 19.3-fold at
24 h p.i., a combination of PoIFN-α and PoIFN-γ, or PoIFN-β
and PoIFN-γ, inhibited IE mRNA expression 23.8–133-fold. These data
suggest that PoIFN-α/β and PoIFN-γ have a synergistic inhibitory
action on the regulation of IE gene expression.
Here, we have demonstrated that PoIFN-β was the most efficient
of the three PoIFNs in promoting resistance to PRV, and PoIFN-γ
together with the PoIFN-α/β act synergistically to inhibit the
replication of PRV in vitro.
References
1 Pomeranz LE, Reynolds AE, Hengartner CJ. Molecular
biology of pseudorabies virus: impact on neurovirology and
veterinary medicine. Microbiol Mol Biol Rev 2005; 69: 462-500.
2 Brukman A, Enquist LW. Suppression of the
interferon-mediated innate immune response by pseudorabies virus. J
Virol 2006; 80: 6345-56.
3 Taharaguchi S, Hayashi H, Yoshino S,
Amagai K, Ono E. The pseudorabies virus immediate-early
promoter directs neuronal tissue-specific expression in transgenic
mice. Arch Viro 2003; 148: 913-23.
4 Kit S. Pseudorabies virus. In: Webster RG,
Granoff A, eds. “Encyclopedia of Virology”. London: Academic
Press, 1994: 1173-9; (Vol 3).
5 Albina E, Carrat C, Charley B. Interferon-alpha
response to swine arterivirus (PoAV), the porcine reproductive and
respiratory syndrome virus. J Interferon Cytokine Res 1998; 18:
485-90.
6 Bautista EM, Molitor TW. IFN gamma inhibits porcine
reproductive and respiratory syndrome virus replication in
macrophages. Arch Virol 1999; 144: 1191-200.
7 Chinsangaram J, Moraes MP, Koster M,
Grubman MJ. Novel viral disease control strategy: adenovirus
expressing alpha interferon rapidly protects swine from
foot-and-mouth disease. J Virol 2003; 77: 1621-5.
8 Xia C, Dan W, Wen-Xue W, Jian-Qing W,
Li W, Tian-Yao Y, Qin W, Yi-Bao N. Cloning and
expression of interferon-alpha/gamma from a domestic porcine breed
and its effect on classical swine fever virus. Vet Immunol
Immunopathol 2005; 104: 81-9.
9 Sainz Jr. B, Halford WP. Alpha/Beta interferon
and gamma interferon synergize to inhibit the replication of herpes
simplex virus type 1. J Virol 2002; 76: 11541-50.
10 Larkin J, Jin L, Farmen M, Venable D,
Huang Y, Tan SL, Glass JI. Synergistic antiviral
activity of human interferon combinations in the hepatitis C virus
replicon system. J Interferon Cytokine Res 2003; 23: 247-57.
11 Sainz Jr. B, Mossel EC, Peters CJ,
Garry RF. Interferon-beta and interferon-gamma synergistically
inhibit the replication of severe acute respiratory
syndrome-associated coronavirus (SARS-CoV). Virology 2004; 329:
11-7.
12 Asper M, Sternsdorf T, Hass M, Drosten C,
Rhode A, Schmitz H, Gunther S. Inhibition of
different Lassa virus strains by alpha and gamma interferons and
comparison with a less pathogenic arenavirus. J Virol 2004; 78:
3162-9.
13 Sainz Jr. B, LaMarca HL, Garry RF,
Morris CA. Synergistic inhibition of human cytomegalovirus
replication by interferon-alpha/beta and interferon-gamma. Virol J
2005; 2: 14.
14 Schijns V, van Giersbergen P, Schellekens H,
Horzinek MC. Recombinant interferon-gamma applied to the brain
ventricular system protects rats against pseudorabies. J
Neuroimmunol 1990; 28: 1-7.
15 Tonomura N, Ono E, Shimizu Y, Kida H.
Negative regulation of immediate-early gene expression of
pseudorabies virus by interferon-alpha. Vet Microbiol 1996; 53:
271-81.
16 Cao RB, Zhou GD, Zhou HX, Bao JJ,
Chen PY. Secreted expression of porcine interferon beta in
Pichia pastoris and its inhibition effect on the replication of
pseudorabies virus. Acta Microbiol Sin 2006; 46: 412-7.
17 Huanchun C, Liurong F, Qigai H, Meilin J.
Study on the isolation and identification of the Ea strain of
pseudorabies virus. Acta Vet et Zootech Sinica 1998; 29:
156-61.
18 Harouse JM, Bhat S, Spitalnik SL,
Laughlin M, Stefano K, Silberberg DH,
Gonzalez-Scarano F. Inhibition of entry of HIV-1 in neural
cell lines by antibodies against galactosyl ceramide. Science 1991;
253: 320-3.
19 Himathongkham S, Luciw PA. Restriction of HIV-1
(subtype B) replication at the entry step in rhesus macaque cells.
Virology 1996; 219: 485-8.
20 Inabe K, Nishizawa M, Tajima S, Ikuta K,
Aida Y. The YXXL sequences of a transmembrane protein of
bovine leukemia virus are required for viral entry and
incorporation of viral envelope protein into virions. J Virol 1999;
73(2): 1293-301.
21 Treco DA. Preparation and analysis of DNA. In:
Ausubel FM, ed. Current protocols in molecular biology. New
York, N.Y: John Wiley & Sons, 1990: 203-23.
22 Xiao SB, Fang LR, Xu JX, Hong WZ,
Chen HC. Cloning of the immediate-early gene IE180 of
pseudorabies virus Ea strain and its expression in E.coli. Chin J
Vet Sci 2003; 23: 249-51.
23 Pfaffl MW. A new mathematical model for relative
quantification in real-time RT-PCR. Nucleic Acids Res 2001; 29:
e45.
24 Ono E, Watanabe S, Nikami H, Tasaki T,
Kida H. Pseudorabies virus (PRV) early protein 0 activates PRV
gene transcription in combination with the immediate-early protein
IE180 and enhances the infectivity of PRV genomic DNA. Vet
Microbiol 1998; 63: 99-107.
25 Goodbourn S, Didcock L, Randall E.
Interferons: cell signalling, immune modulation, antiviral response
and virus countermeasures. J Gen Virol 2000; 81: 2341-64.
26 Der SD, Zhou A, Williams BR,
Silverman RH. Identification of genes differentially regulated
by interferon alpha, beta, or gamma using oligonucleotide arrays.
Proc Natl Acad Sci USA 1998; 95: 15623-8.
27 Ono E, Tasaki T, Kobayashi T, et al.
Resistance to pseudorabies virus infection in transgenic mice
expressing the chimeric transgene that represses the
immediate-early gene transcription. Virology 1999; 262: 72-8.
|
Printable version
Version PDF
