ARTICLE
Auteur(s) : Evemie Schutyser1,2, Yingjun
Su2, Yingchun Yu2, Mieke Gouwy1,
Snjezana Zaja-Milatovic2, Jo van
Damme1, Ann Richmond2
1Laboratory of Molecular Immunology, Rega Institute
for Medical Research, University of Leuven, Belgium
2Departments of Veterans Affairs and Cancer Biology,
Vanderbilt University School of Medicine, Nashville, TN, USA
Angiogenesis is a crucial step in cancer progression and metastasis
[1-3]. The formation of new blood vessels is essential for the
adequate supply of oxygen and serum factors to the growing tumor.
Chemokines constitute a family of chemotactic cytokines that can
affect many aspects of cancer biology, including the balance
between angiogenesis and angiostasis [3-5]. Chemokines exert their
various functions mostly through activation of 7-transmembrane
domain G protein-coupled chemokine receptors [4]. Depending on the
presence and positioning of NH2-terminal cysteines, chemokines can
be grouped into four classes, with the CC and the CXC chemokines
being the most prominent. The CXC chemokines are further subdivided
into the ELR+ and ELR- CXC chemokines based on the presence or
absence of a Glu-Leu-Arg (ELR) motif near the NH2-terminus,
respectively. The ELR+ CXC chemokines, such as CXCL1 through CXCL3
and CXCL5 through CXCL8, have been shown to promote the growth of
new capillaries, likely through their common receptor, CXCR2 [3, 5,
6]. On the other hand, some ELR- CXC chemokines, including CXCL4,
the CXCR3 ligands CXCL9, CXCL10 and CXCL11, the CXCR5 ligand CXCL13
and CXCL14 are angiostatic, although their mechanism of action has
not been completely clarified [3, 5, 7-11]. For years, no agonistic
receptor could be identified for CXCL4 and CXCL14 and the
discussion is still open as to whether the CXCR3 ligands and the
CXCR5 ligand CXCL13 exert their angiostatic activity through their
respective chemokine receptors [3, 5, 8, 9]. Lasagni et al. argued
that a splice variant of the classic CXCR3 receptor, namely CXCR3B,
might mediate the angiostatic activity of both the CXCR3 ligands
and CXCL4 [12]. However, it can still not be excluded that these
angiostatic ELR- CXC chemokines could also act
receptor-independently by inhibiting angiogenic factors (e.g. by
forming heterodimers or by occupying common binding sites on
glycosaminoglycans presented on the endothelial surfaces), or
through an unknown receptor [3, 10]. Furthermore, the distinction
between angiogenic and angiostatic chemokines goes beyond the
presence or absence of the ELR motif, since the ELR- CXC chemokines
CXCL12 (through its receptor CXCR4) [5] and CXCL16 [13] also
display angiogenic properties. Finally, some CC chemokines,
including CCL1, CCL2 and CCL11, have also been reported to
stimulate the growth of blood vessels [5].Many reports relating
chemokines and chemokine receptors to endothelial cells and the
angiogenesis/angiostasis balance have utilized human umbilical vein
endothelial cells to generate in vitro results [14-16]. However,
these macrovascular endothelial cells are functionally and
phenotypically quite different from microvascular endothelial
cells, which are more likely to be involved in physiological and
pathological angiogenesis [17, 18]. Even the reported expression
patterns of the most intensively studied chemokine receptors in
endothelial cells, namely CXCR2, CXCR3 and CXCR4, are rather
divergent [5, 14-16, 19-26]. Furthermore, the information on the
regulation of the expression of these CXC chemokine receptors in
microvascular endothelial cells remains scarce [19, 24, 25]. To
gain more insight in this issue, we analysed the in vitro
expression of CXCR2, CXCR3, CXCR4 and CXCR7/RDC1, recently assigned
as an alternative CXCL12 receptor [27], in dermal human
microvascular endothelial cells. We evaluated in particular, the
impact of environmental factors such as inflammatory cytokines,
matrix components, oxygen levels and serum factors. Furthermore, we
compared our in vitro findings with in vivo expression of these
receptors in human metastatic melanoma lesions.
Methods
Cells and reagents. Primary human dermal microvascular endothelial
cells (HMVEC; Cascade Biologics, Portland, OR, USA; below passage
12), were routinely grown on 0.1% gelatin-coated flasks in Medium
131 (Cascade Biologics) supplemented with Microvascular Growth
Supplement (MVGS; Cascade Biologics; final concentration of 5% FBS)
following the provider’s instructions. Immortalized human dermal
microvascular endothelial cells (HMEC-1; CDC Atlanta, GA, USA;
below passage 25) were routinely cultured in MCDB 131 medium
(Invitrogen, Carlsbad, CA, USA) enriched with 10% FBS (Hyclone,
Logan, UT, USA), 10 mM Lglutamine (Mediatech Cellgro, Herndon, VA,
USA) and Endothelial Cell Growth Supplement (ECGS; Upstate Cell
Signaling, Lake Placid, NY, USA; 15 μg/ml) or in Endothelial Basal
Medium-2 (EBM-2; Cambrex Bio Science, Walkersville, MD, USA)
supplemented with Endothelial Growth Medium (EGM-2MV SingleQuots;
Cambrex Bio Science; final concentration of 5% FBS). The human
axillary node-derived metastatic melanoma cell line SK-MEL-5 and
the pleural effusion-derived metastatic breast adenocarcinoma cell
line MCF7 were purchased from the American Type Culture Collection
(Manassas, VA, USA). The SK-MEL-5 cells and the MCF7 cells were
cultured in DMEM-F12 or DMEM medium (Mediatech Cellgro),
respectively, supplemented with 10% FBS and 2 mM L-glutamine. Human
peripheral blood mononuclear cells (PBMC) were freshly isolated
from single blood donations (blood transfusion center of Leuven,
Belgium). Erythrocytes were removed by sedimentation in
hydroxyethyl starch (Plasmasteril; Fresenius Hemotechnology, Bad
Homburg, Germany) for 30 min at 37°C. PBMC were further
purified by density gradient centrifugation on Ficoll-sodium
diatrizoate (Lymphoprep; Axis-Shield PoC AS, Oslo, Norway) for
30 min at 400 g. The basement membrane matrix components
gelatin and collagen type IV were purchased from Sigma-Aldrich (St.
Louis, MO, USA) and growth factor-reduced Matrigel is a basement
membrane preparation commercialized by BD Biosciences (San Jose,
CA, USA). The cytokines VEGF, GM-CSF, IL-1β and TNF-α and the
chemokine CXCL12 were purchased from PeproTech (Rocky Hill, NJ,
USA), whereas IFN-γ came from R&D Systems (Minneapolis, MN,
USA). The mouse monoclonal anti-CXCR3 antibody clone 49801 (MAB160;
0.5 mg/ml), anti-CXCR4 antibody clone 12G5 (MAB170; 0.5 mg/ml) and
anti-CXCR4 antibody clone 44708 (MAB171; 1 mg/ml) were obtained
from R&D Systems and the mouse monoclonal anti-CXCR3 antibody
clone 1C6 (1 mg/ml) was ordered from BD Biosciences. The rabbit
polyclonal anti-CXCR2 antibody was previously characterized [28,
29] and the mouse monoclonal anti-CXCR7 antibody (1.6 mg/ml) was
developed by Infantino et al. [30]. Mouse IgG isotype control
antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and goat
anti-mouse phycoerythrin (PE)- conjugated IgG (Jackson
ImmunoResearch, Westgrove, PA, USA) were used during FACS analysis.
RNA isolation and semi-quantitative RT-PCR analysis Primary
HMVEC (0.2x106 cells/p60 plate) and immortalized HMEC-1 cells
(0.5x106 cells/p60 plate) were grown on 0.1% gelatin in their
complete culture medium (see above) until 80% confluence was
reached (72 h). The cells were then washed, re-suspended in
medium containing 0.5% FBS and stimulated for 4 h at 37°C with
10 ng/ml of cytokine or left untreated. In order to investigate the
influence of matrix components, serum factors and oxygen
concentrations on chemokine receptor mRNA expression, HMEC-1 cells
(1x106 cells/p60 plate) were plated on various basement membrane
matrix components, namely gelatin (0.1%), collagen type IV (20
μg/ml) or Matrigel (0.25 mg/ml). After 48 h of culturing with
their complete culture medium, cells were washed and further
incubated for 6 h with 0.5 or 10% FBS under normoxic or
hypoxic conditions (in hypoxic GasPak pouches, BD Biosciences).
Human melanoma SK-MEL-5 cells (1x106 cells/p60 plate) were grown
until confluency in complete culture medium, washed and also
further incubated for 6 h under normoxia or hypoxia with 0.5
or 10% FBS. After the appropriate incubation of the endothelial and
SK-MEL-5 cells, RNA was isolated with the RNeasy kit (Qiagen,
Valencia, CA, USA) with an on-column DNAse treatment (RNAse free
DNAse set; Qiagen). Next, 1μg of RNA was reverse transcribed using
AMV reverse transcriptase (AMV-RT; 0.2 U/μl; Promega, Madison, WI,
USA) and its buffer in the presence of oligod(T)16 primers (1 μM;
Applied Biosystems, Foster City, CA, USA), 0.2 mM of each of the
dNTPs (Sigma-Aldrich) and RNAse inhibitor (RNAsin, 0.4 U/μl;
Promega) in a 25 μl reaction mixture. Prior to adding all these
reagents and incubation for 1 h at 42°C, the oligod(T)16
primers had been allowed to anneal to the poly-A-tail of mRNA
strands for 5 min at 70°C. In parallel, reactions were carried
out in the absence of reverse transcriptase as negative controls
(non-RT), whereas cDNA generated from PBMC and MCF7 cells could
serve as positive controls. The PCR reaction mixture (25 μl)
contained 1 μl of reverse transcription mixture in the presence of
Taq DNA polymerase (0.06 U/μl; Sigma-Aldrich) and its buffer, 0.2
mM of each of the dNTPs and 0.4 μM of the primer pairs. The PCR
reaction consisted of 7 min denaturation at 95°C, followed by
20 or 37 cycles (in case of GAPDH or chemokine receptor primers,
respectively) of 1 min denaturation at 95°C, 1 min
annealing at 58°C and 2 min extension at 72°C, and was
concluded by a final extension step of 10 min at 72°C. The
primer pair for the housekeeping gene GAPDH (NM_002046; Forward: 5’
TCATTGACCTCAACTACATGG; Reverse: 5’ GAGTCCTTCCACGATACCAAA) generated
a RT-PCR fragment of 413 bp. The CXCR4 primers (NM_003467; Forward:
5’ CACTTCAGATAACTACACCG; Reverse: 5’ ATCCAGACGCCAACATAGAC)
amplified a fragment of 464 bp. The primer pairs for CXCR2
(NM_001557; Forward: 5’ CGAAGGACCGTCTACTCATC; Reverse:
5’AGTGTGCCCTGAAGAAGAGC) and for CXCR7 (NM_020311; Forward: 5’
AAGAAG ATGGTACGCCGTGTCGTCTGCATCCTG; Reverse: 5’
CTGCTGTGCTTCTCCTGGTCACTGGACGCCGAG) have been published previously,
generating fragments of 519 bp and 281 bp, respectively [31, 32].
Finally, three different CXCR3 primer pairs were tested.
Theoretically, the CXCR3 primer pair used by Segerer et al. (CXCR3
Seg; Forward: 5’ GCCCTCTACAGCCTCCTCTT; Reverse: 5’
TGTTCAGGTAGCGGTCAAAGC) [33] should assist in the generation of an
RT-PCR fragment of 286 bp, independent of the origin of the CXCR3
template (CXCR3A mRNA, CXCR3B mRNA, CXCR3alt mRNA or genomic DNA;
see table 1. The primer set from Soejima
and Rollins (CXCR3 Soe; Forward: 5’ AACCACAAGCACCAAAGCAG; Reverse:
5’ TGATGTTGAAGAGGGCACCT) [34] is supposed to distinctively amplify
RT-PCR fragments of 466 bp (CXCR3A or CXCR3-alt mRNA), 705 bp
(CXCR3B mRNA) or 1444 bp (genomic DNA). Finally, the CXCR3 primer
pair applied by Feil and Augustin (CXCR3 Fei; Forward: 5’
CCACTGCCAATACAACTTCC; Reverse: 5’ GCAAGAGCAGCATCCACATC) [19] leads
to an RT-PCR fragment of 401 bp in the presence of CXCR3A mRNA,
CXCR3B mRNA or genomic DNA and an RT-PCR fragment of 64 bp with
CXCR3-alt as template. To visualize the amplification products, 16
μl of the RT-PCR mixtures were loaded on 2% agarose gels. The
specificity of the primers was confirmed by sequencing some RT-PCR
fragments after their isolation from these gels with the Qiaquick
gel extraction kit (Qiagen). After densitometric analysis of the
bands corresponding to the amplified chemokine receptor transcripts
and the loading control GAPDH, the ratios of the chemokine receptor
relative to the GAPDH PCR products were calculated and normalized
against the ratios of control samples. Experiments were
independently repeated three to four times and statistically
significant differences compared to the control samples were
determined with the Mann-Whitney U test. FACS analysis HMEC-1 cells
(3x106 cells/T75) were allowed to attach for 24 h in complete
culture medium, washed and incubated under normoxic conditions in
the presence of 10% FBS or in a hypoxic GasPak pouch in the
presence of 0.5% FBS. After 24 h, cells were washed with DMEM,
detached with enzyme-free cell dissociation buffer (Invitrogen) and
washed twice with ice-cold FACS buffer (DMEM+0.5% FBS).
Subsequently, cells (0.5x106) were labeled with anti-CXCR4 antibody
clone 12G5 (1/50 dilution), anti- CXCR4 antibody clone 44708 (1/100
dilution), anti-CXCR7 antibody (1/80 dilution) or the mouse IgG
isotype control antibody (1/40 dilution) for 1 h on ice. After
washing, cells were incubated with goat anti-mouse PE-conjugated
IgG for 1 h on ice, in the dark. Finally, cells were washed
three times with ice-cold FACS buffer and analyzed using a FACS
Calibur flow cytometer (BD Biosciences). For the analysis of ERK1/2
phosphorylation, HMEC-1 cells (0.5x106 cells/well) were grown in a
6-well plate for 24 h in complete culture medium until 70%
confluency was reached. After washing, cells were serum-starved
(0.5% FBS) for 24 h under normoxic or hypoxic (GasPak pouch)
conditions. Subsequently, cells were refreshed with 900 μl EBM-2
medium containing 0.5% FBS and preincubated at 37°C for 15 min
prior to treatment with 100 μl CXCL12 solution (final concentration
100 ng/ml) for 1, 5 or 20 min or with 100 μl control medium
for 5 min (Co) at 37°C. Cell treatment was stopped by chilling
the cells on ice, adding ice-cold PBS and washing the cells twice
with ice-cold PBS. Cells were lysed by incubation with ice-cold PBS
(100 μl/well) containing 1 mM EDTA, 0.5% Triton X-100, 5 mM NaF, 6
M urea and protease inhibitor cocktail for mammalian tissues and
phosphatase inhibitor cocktails 1 and 2 (all 1/100; Sigma-Aldrich).
After 10 min, the cells were scraped off and the cell extracts
were collected, incubated for another 45 min on ice and
clarified (10 min, 1200 g). The total protein content in the
cell extracts was measured with the bicinchoninic acid (BCA)
protein assay (Pierce, Rockford, IL, USA). The amount of
phosphorylated ERK1 and phosphorylated ERK2 (p-ERK1/ERK2) was
detected with the DuoSet p-ERK1/ERK2 sandwich ELISA (R&D
Systems). The ratios of the amount of p- ERK1/2 to the total
protein content were calculated and normalized against the ratio of
the buffer-treated control sample. Statistically significant
differences compared to the control cells were determined with the
Mann-Whitney U test.
Immunohistochemical staining of melanoma patient samples.
Tumor tissue samples were collected from 12 melanoma patients
using protocols approved by the Vanderbilt University Institutional
Review Board. The majority of the melanoma samples were from
metastatic origin (five lymph node metastases, one visceral
metastasis, one skin/soft tissue metastasis, and four without
additional information), whereas one sample was derived from a
primary melanoma lesion. After fixation, the tumors were embedded
in paraffin, cut into slices and placed onto glass slides. The
sections were first deparaffinized/hydrated by washing the slides
three times for 10 min with xylene, twice for 10 min with
100% ethanol and twice for 10 min with 95% ethanol. The
sections were then washed twice in dH2O for 5 min,
followed by a wash step with PBS for 5 min. For antigen
unmasking, sections were heated in 10 mM sodium citrate buffer (pH
6.0) for 1 min at full power, followed by 9 min at medium
power. After allowing the sections to cool down for 20 min,
they were washed three times with dH2O for 5 min
and incubated for 10 min in 1% H2O2 to
quench endogenous peroxidases. Subsequently, sections were washed
three times with dH2O for 5 min, once with PBS for
5 min and then blocked with 5% normal horse serum (RTU
Vectastain Universal ABC kit; Vector Laboratories, Burlingame, CA,
USA) in PBS for 1 h at room temperature. The sections were
then incubated overnight at 4°C with the primary antibodies diluted
in 2% normal horse serum in PBS, namely anti- CXCR2 (1/150),
anti-CXCR3 from R&D (1/100), anti-CXCR3 from BD Biosciences
(1/25), anti-CXCR4 clone 12G5 (1/10), anti-CXCR4 clone 44708 (1/40)
or anti-CXCR7 (1/100). After washing three times for 5 min
with PBS, the secondary antibodies (RTU Vectastain Universal ABC
kit) were added. After 30 min of incubation at room
temperature, the sections were washed three times for 5 min
with PBS and incubated for 30 min at room temperature with ABC
reagent (RTU Vectastain Universal ABC kit). After removal of the
ABC reagent, sections were washed three times with PBS for
5 min and incubated at room temperature with AEC substrate
(Vector Laboratories). As soon as the sections turned red (after 10
to 30 min), they were immersed in dH2O,
counterstained for 1 min in hematoxylin, washed in
dH2O and finally mounted with coverslips. Stained
melanoma sections were analysed with a Nikon Labophot microscope
(Melville, NY, USA). For each of the anti-chemokine receptor
antibodies tested, at least 10 of the 12 melanoma sections were
investigated. Sections in which the primary antibody was omitted,
served as negative controls.
Table 1 Expected size of RT-PCR fragments depending on
the CXCR3 primers used (CXCR3fei, CXCR3soe, CXCR3seg) and on the
origin of the CXCR3 template
|
CXCR3A
|
CXCR3B
|
CXCR3alt
|
Genomic
|
|
mRNA
|
mRNA
|
mRNA
|
DNA
|
|
CXCR3fei [19]
|
401 bp
|
401 bp
|
64 bp
|
401 bp
|
|
CXCR3soe [34]
|
466 bp
|
705 bp
|
466 bp
|
1444 bp
|
|
CXCR3seg
|
286 bp
|
286 bp
|
286 bp
|
286 bp
|
Results
Transcriptional regulation of CXCR2, CXCR3 and CXCR4 by
inflammatory cytokines in microvascular endothelial cells In order
to study the regulated expression of the CXC chemokine receptors
CXCR2, CXCR3 and CXCR4 in microvascular endothelial cells, we
performed semi-quantitative RT-PCR experiments on RNA that was
isolated from primary (HMVEC cells) or from immortalized dermal
human microvascular endothelial cells (HMEC-1 cell line). The
housekeeping gene GAPDH was used as an internal control. The
specificity of the various primers was initially demonstrated by
the appearance of single DNA bands following RT-PCR analysis of RNA
obtained from freshly isolated peripheral blood mononuclear cells
(PBMC) and the lack of any bands in the absence of reverse
transcriptase (figure
1A). Sequence analysis of the RT-PCR fragments obtained
after gel extraction confirmed their identity. To evaluate the
regulation of chemokine receptor expression, microvascular
endothelial cells were stimulated for 4 h with 10 ng/ml VEGF,
GM-CSF, IFN-γ, IL-1β or TNF-α in the presence of 0.5% FBS and RNA
was subsequently isolated. Figure 1B depicts the
results obtained for CXCR4 as the mean of four separate sets of
semiquantitative RT-PCR experiments with primary HMVEC and
immortalized HMEC-1 cells. VEGF, GM-CSF and IL-1 β did not
considerably affect the amounts of CXCR4 transcripts in these
microvascular endothelial cells. However, TNF-α significantly
reduced the CXCR4 mRNA levels in both cell types, and IFN-γ caused
only downregulation of these transcripts in immortalized HMEC-1
cells. Even in the presence of these stimuli, the CXCR2 mRNA levels
remained below the detection level in primary HMVEC cells and were
too low for firm conclusions to be drawn in HMEC-1 cells (data not
shown). Various splicing variants have been reported for CXCR3 in
different cell types, namely the classic CXCR3A, the potentially
angiostatic CXCR3B [12] and finally CXCR3alt [35]. We analysed the
regulated expression of CXCR3 by human microvascular endothelial
cells using three sets of previously published primers (table 1) [19, 33, 34]. As a control, RT-PCR
analysis of PBMC-derived RNA generated fragments of 401 bp, 466 bp
and 286 bp using the CXCR3 Fei, CXCR3 Soe and CXCR3 Seg primer
sets, respectively, that could not be due to genomic contamination
(figure 1A).
However, no CXCR3-derived RT-PCR fragments could be detected in the
microvascular HMVEC or HMEC-1 cells with any of these CXCR3 primer
pairs, not even after stimulation by cytokines (figure 2) and data not
shown). Insufficient oxygen or serum factor increases CXCR4
transcription in microvascular endothelial and melanoma cell lines
We next investigated whether factors other than cytokines, such as
matrix components or the deprivation of serum factors and oxygen,
could influence CXC chemokine receptor expression. In the presence
of 10% FBS and normal oxygen concentrations (normoxic conditions),
no major differences in CXCR4 mRNA levels were observed upon
culturing of HMEC-1 cells for 48 h on various basement
membrane matrix components, namely gelatin, collagen type IV or
Matrigel, a commercially available basement membrane preparation
(figure 3A, 3B).
However, if these endothelial cells were then incubated for an
additional 6 h under hypoxic versus normoxic conditions, CXCR4
mRNA expression was significantly up-regulated (figure 3A, 3B). The CXCR4
levels were also increased when the HMEC-1 cells were kept under
normoxic conditions but serum-starved (0.5% FBS) during these
additional 6 h. Furthermore, the CXCR4 up-regulation was
reinforced by combining the hypoxic and serum starvation
conditions, but remained independent of the basement membrane
matrix components used for coating (figure 3A, 3B). In
contrast, changing the oxygen or serum concentrations or the
coating agents did not consistently influence the CXCR2 expression
levels (figure
3A) and left the CXCR3 mRNA levels undetectable in HMEC-1
cells (data not shown). The hypoxia-dependent CXCR4 up-regulation
was not endothelial cell-specific, since we obtained similar
results for human melanoma SK-MEL-5 cells. Indeed, CXCR4 mRNA
expression was much higher in SK-MEL-5 cells cultured with 0.5% FBS
under hypoxic than under normoxic conditions, but was only slightly
more elevated compared to SK-MEL-5 cells treated with hypoxia in
the presence of 10% FBS (figure 3A, 3C). However,
the CXCR2 and CXCR3 expression remained, respectively, very low or
undetectable in the melanoma SK-MEL-5 cells under all conditions
tested figure 3A
and data not shown).
Presence of CXCR7 mRNA in human microvascular endothelial but
not melanoma cell lines.
For a long time, CXCR4 was believed to be the chemokine receptor
unique for CXCL12. Recently however, CXCL12 was nominated as a
putative ligand for the orphan receptor RDC1, and hence renamed as
CXCR7 [27]. We therefore investigated the presence and the hypoxic
inducibility of CXCR7 in human microvascular endothelial cells.
Although CXCR4 was observed in all the semi-quantitative RT-PCR
experiments carried out with the HMEC-1 cell line, CXCR7
transcripts were only detected in 25% of these experiments (figure 4).
Nevertheless, sequence analysis confirmed that the RT-PCR fragment
of 281 bp obtained with the CXCR7 primers in HMEC-1 cells as well
as in PBMC and MCF7 breast carcinoma cells corresponded to the
expected CXCR7 sequence. In those experiments where CXCR7 could be
demonstrated, more CXCR7 transcripts were detected after hypoxic
compared to normoxic treatment of the HMEC-1 cells (figure 4). No CXCR7
transcripts could be observed in the CXCR4-expressing melanoma
SK-MEL-5 cells. Low oxygen/serum factor levels up-regulate CXCR4
but not CXCR7 surface expression in HMEC-1 cells. We next
investigated whether the hypoxia/starvation regulated-CXCR4 and
-CXCR7 expression had any impact on the presence of these receptors
at the endothelial cell surface. Flow cytometry demonstrated that
HMEC-1 cells did not display CXCR4 or CXCR7 proteins on their
surface when cultured under normoxic conditions in the presence of
10% FBS (figure
5). However, 24 h under hypoxic conditions in the
presence of 0.5% FBS allowed for the detection of CXCR4 on the
HMEC-1 cell surface (figure 5). This
up-regulated CXCR4 surface expression was clearly demonstrated
using the anti- CXCR4 antibody clone 44708, whereas the anti-CXCR4
antibody clone 12G5 was generally less sensitive in the FACS
analysis. This treatment of HMEC-1 cells with low oxygen and low
serum concentrations did not however lead to a detectable increase
in CXCR7 surface expression levels using the anti-CXCR7 antibody
developed by Infantino et al. (figure 5) [30].
Furthermore, no CXCR2 or CXCR3 membrane expression could be
observed in the HMEC-1 cells under these conditions (data not
shown).
Hypoxia enhances CXCL12-mediated ERK signaling in HMEC-1
cells.
To evaluate the biological relevance of the hypoxic regulation
of the CXCR4 expression in HMEC-1 cells, we investigated the in
vitro activation of the mitogen-activated protein kinase ERK1/2
(extracellular signal-regulated kinase 1/2) in response to CXCL12.
No ERK1/2 phosphorylation could be observed unless the HMEC-1 cells
underwent hypoxic treatment for 24 h in the presence of 0.5%
FBS prior to CXCL12 stimulation (figure 6). This indicates
that hypoxia promoted CXCR4 transcription and functional CXCR4
expression leading to CXCL12-mediated signal transduction in serum
starved HMEC-1 cells.
CXCR2, CXCR3, CXCR4 and CXCR7 immunoreactivity on endothelial
and tumor cells in melanoma tissue.
Since in vitro expression profiles do not automatically reflect
the in vivo situation, we analyzed the presence of CXCR2, CXCR3,
CXCR4 and CXCR7 in human melanoma tissues. Immunohistochemical
staining of at least 10 different melanoma samples for each
chemokine receptor demonstrated that all these receptors were often
expressed on the melanoma tumor cells and to a lesser extent on the
endothelial cells (figure 7). The tumor cells
were positively stained with our previously characterized
anti-CXCR2 antibody in 100% of the melanoma samples, and in 50% of
these samples some endothelial cells also displayed CXCR2
immunoreactivity (figure
7A) [28, 29]. Strong CXCR3 staining was obtained with the
anti-CXCR3 antibody from R&D Systems in 100% of the melanoma
samples, and 90% of those tumor samples also showed CXCR3
immunoreactivity in the blood vessels (figure 7B). CXCR4 was also
detected in 100% of the tumor samples, with 80% of those tissues
showing CXCR4 positive blood vessels using anti-CXCR4 antibody
clone 44708 (figure
7E). However, depending upon the antibody used for
staining, the levels of detection were variable. Less
immunostaining was observed with the anti-CXCR3 antibody from BD
Biosciences (figure
7C) and with anti-CXCR4 antibody clone 12G5 (figure 7D). Although
anti-CXCR3 antibody from BD Biosciences still stained 80% of the
tumor samples of which 75% contained CXCR3 positive blood vessels,
the staining was less intense than with anti-CXCR3 antibody from
R&D Systems. Positive immunoreactivity with the anti-CXCR4
antibody clone 12G5 (figure 7D) was only
obtained in 40% of the melanoma sections, and in 50% of these
positive samples, some endothelial cells were also slightly stained
for CXCR4. Finally, CXCR7 was expressed in 70% of the melanoma
samples and blood vessels. In 50% of these positive samples there
was also positive staining for CXCR7 using the anti-CXCR7 antibody
developed by Infantino et al. (figure 7F) [30].
Discussion
The expression of CXCR2, CXCR3 and CXCR4 by endothelial cells has
already been well addressed by various research groups, the results
pointing toward the potential involvement of these receptors and
their ligands in fine-tuning the balance between stimulation and
inhibition of new vessel growth [3, 6, 14-16, 20, 22]. However,
endothelial cells used for in vitro experiments can originate from
various species, donors, organs or types of vasculature and often
display different phenotypical characteristics [1, 2, 18]. Since
microvascular endothelial cells are more likely to participate in
angiogenesis and inflammation, they represent a better target for
studying the expression of potential angiogenic or angiostatic CXC
chemokine receptors than the more often used macrovascular human
umbilical vein endothelial cells (HUVEC) [1, 18]. In addition,
little is known regarding the influence of environmental factors on
the expression of these CXC chemokine receptors in human
microvascular endothelial cells. Therefore, we performed
semi-quantitative RT-PCR experiments to compare the inducibility of
CXCR2, CXCR3 and CXCR4 by various cytokines in primary (HMVEC) and
immortalized (HMEC-1) human dermal microvascular endothelial cells.
Only TNF-α down-regulated CXCR4 mRNA expression in both HMVEC and
HMEC-1 cells after 4 h, whereas IFN-γ reduced the CXCR4
transcript levels only in the HMEC-1 cells. No effect on CXCR4 mRNA
levels was observed with VEGF, GM-CSF or IL-1β and the presence of
various basement membrane matrix components also did not influence
CXCR4 expression. In contrast to the inhibitory role for TNF-α and
IFN-γ, CXCR4 mRNA was strongly induced by insufficient oxygen
and/or serum, in both HMVEC (data not shown) and HMEC-1 cells.
Furthermore, no CXCR2 transcription was detected in HMVEC cells,
and the low CXCR2 mRNA levels present in HMEC-1 cells were not
consistently affected by any of these factors (cytokines, matrix
components, hypoxia or serum starvation). In addition, we did not
observe any CXCR3 mRNA expression in any of our experimental
settings with the cultured endothelial cells tested. Our FACS data
confirmed the hypoxic up-regulation of CXCR4 since we could only
observe CXCR4 surface expression in HMEC-1 cells after hypoxic
treatment. In contrast to our data, Feil and Augustin reported as
data (not shown) that TNF-α down-regulated CXCR3 mRNA but increased
the CXCR2 levels upon 4 h treatment of human microvascular
endothelial cells [19]. Yoshida et al. also showed higher amounts
of CXCR2 transcripts in the presence of TNF-α [25], whereas this
increase required the co-incubation of TNF-α with LPS in the case
of human intestinal microvascular endothelial cells [21].
Furthermore, bFGF and VEGF enhanced surface CXCR4 expression in
human microvascular endothelial cells after 24 h of
stimulation, mainly through an indirect, prostaglandin E2-mediated
pathway [24, 36]. More information is available on the regulated
expression of CXCR2, CXCR3 and CXCR4 in the macrovascular HUVEC
cells [14, 16, 19, 37, 38]. Importantly, Schioppa et al. described
that the hypoxia-mediated up-regulation of CXCR4 occurs in HUVEC as
well [37]. Furthermore, the CXCR4 mRNA levels in HUVEC were
continuously suppressed after stimulation with IFN-γ for 1 h
up to 24 h, whereas they decreased after TNF-α treatment for 1
to 5 h, but started to increase again afterwards [14]. Our
RT-PCR and FACS data are in agreement with most previous reports
pointing to CXCR4 as the most abundantly expressed chemokine
receptor in microvascular and macrovascular endothelial cells
compared to the lower or even undetectable expression levels of
CXCR2 and CXCR3 [5, 14-16, 19, 20]. The relatively small degree of
chemokine receptor expression at the mRNA and protein level in in
vitro-cultured endothelial cells could account for the various,
contradictory findings by different groups in the past [14-16,
19-26]. The differences in experimental conditions (such as number
of cell passages, presence of growth supplements or serum prior to
or during experiments, time lapse of experiments) and origin of the
micro- and macrovascular endothelial cells, certainly contribute to
this variability [17, 18]. It is likely that primary endothelial
cells lose their in vivo expression pattern of chemokine receptors
once they start to be cultured in vitro, as shown for CXCR4 in
microvascular human bone marrow endothelial cells [17, 18, 26].
This might help clarify our low to undetectable CXCR2 and CXCR3
mRNA levels in HMEC-1 and HMVEC cells. Furthermore, the
specificity/efficiency of some of the antibodies widely used in the
different reports for Western blotting, FACS staining or
immunochemical staining of cells or tissues is an important issue
(e.g. monoclonal anti-CXCR3 Clone 49801 from R&D Systems versus
Clone 1C6 from BD Pharmingen; antigenically distinct conformations
of CXCR4) [7, 12, 33, 35, 39-41]. This antibody issue might also
partly explain why microvascular endothelial cells seem to be
stained more consistently than expected for CXCR2, CXCR3 and CXCR4
in immunohistological sections from the in vitro findings. Our
immunohistochemical stainings of melanoma tissue showed that the
tumor cells as well as the endothelial vessels, although to a
lesser degree, displayed positive immunoreactivity for CXCR2,
CXCR3, CXCR4 and CXCR7. However, we also noticed much stronger
staining with the anti-CXCR3 antibody from R&D Systems and the
anti-CXCR4 antibody clone 44708 than with the anti-CXCR3 antibody
from BD Biosciences and anti-CXCR4 antibody clone 12G5,
respectively. Our findings nevertheless also confirm previous
reports on the expression of CXCR2, CXCR3 and CXCR4 by melanoma
cells [29, 42]. To verify the presence of these receptors on the
endothelial cell membranes in vitro, some groups permeabilized
their cells in order to obtain better FACS results [20, 22] or
included confocal immunostainings of the endothelial cells showing
clear intracellular, but rather low or unclear membrane-bound
localization of the chemokine receptors [20, 22, 37].
Interestingly, a strong intracellular CXCR4 staining in combination
with an unexpectedly low membrane localization has also been
reported in various other cell types, including melanoma cells [42,
43]. However, even limited surface expression of the chemokine
receptors on endothelial or non-endothelial cells does not
necessarily preclude their biological responsiveness [20, 37, 42].
Hypoxic treatment of the HMEC-1 cells also induced sufficient CXCR4
surface expression to allow us to observe the activation of the ERK
signaling pathway upon CXCL12 stimulation. Furthermore, it cannot
be excluded that intracellularly located CXCR4 could still be
actively involved in signal reactions. The hypoxic regulation of
CXCR4 has already been observed in various cell types [37, 44]. We
also demonstrated increased CXCR4 expression in human melanoma
cells upon hypoxic treatment. In parallel, the up-regulation of
CXCR4 in microvascular endothelial cells caused by the lack of
serum factors and oxygen fits nicely with the concept that CXCR4
promotes the outgrowth of new blood vessels from pre-existing
vessels (strict definition of angiogenesis) and/or from circulating
endothelial progenitor cells (often referred to as vasculogenesis)
in order to restore the oxygen and serum factor supply. Indeed,
there are many in vitro and in vivo findings supporting a role for
the CXCR4/CXCL12 axis in angiogenesis [16, 24, 38, 45-48]. Studies
with CXCR4 and CXCL12 knock-out mice revealed an essential role for
CXCR4 in the vascularization of the gastrointestinal tract [49].
Furthermore, it has become clear that not only differentiated
endothelial cells but also endothelial cell precursors circulating
through the body express CXCR4 [36, 43, 46, 47, 50, 51]. The ERK
activation by CXCL12 in our endothelial cells is also in agreement
with the stimulation of the MAPK pathway by other angiogenic
factors in endothelial cells [13, 21, 52]. Some people however,
argue that CXCR4 is more important for angiogenesis-independent
metastasis and less relevant for angiogenesis as such, due to the
lack of a detectable CXCL12 gradient in vivo towards the tumor and
the relatively low intratumoral CXCL12 expression [3]. However,
other reports show that CXCL12 is nevertheless highly expressed in
some tumors [43, 48, 50] and induced by hypoxia in ovarian cancer
cells [38]. Furthermore, VEGF, bFGF, hypoxia-inducible factor (HIF)
and hypoxia up-regulated CXCL12 expression in endothelial cells
[43, 45, 51], and specific blocking of the CXCL12/CXCR4 axis
results in reduced angiogenesis in vivo [24, 45-47]. CXCL12 has
recently been shown to bind both CXCR4 and the orphan receptor
RDC1, and was hence renamed CXCR7 [27, 53]. Interestingly, RDC1 has
been found to be up-regulated in glioma and colon tumor vasculature
compared to non-neoplastic vasculature, and in microvascular
endothelial cells after infection with Kaposi’s sarcoma-associated
Herpes virus [54, 55]. Furthermore, increased RDC1 transcription
has been observed in rat brain endothelial cells and in human
monocytes [56, 57]. Therefore, we investigated the presence and the
hypoxic inducibility of CXCR7 in human microvascular endothelial
cells. We found that CXCR7 was also up-regulated by hypoxia in
HMEC-1 cells, although its expression was less consistent compared
to CXCR4. Futhermore, no CXCR7 protein was observed on the HMEC-1
cell surface, which makes it less likely that this CXCR7 would be
involved in the ERK activation by CXCL12 in hypoxia-treated HMEC-1
cells. Nevertheless, CXCR7 was clearly present on both the
endothelial and the tumor cells, in human melanoma sections. The
CXCR3 ligands are believed to suppress tumor progression through a
process called immunoangiostatis, specifically by promoting Th1
immunity through Th1 mononuclear cell recruitment towards the tumor
and by simultaneously inhibiting angiogenesis [3, 11, 58]. The way
CXCL9, CXCL10 and CXCL11 could exert their angiostatic activity
directly on endothelial cells remains an open debate. Besides an
angiostatic effect through their interaction with angiogenic
factors or glycosaminoglycans, the chemokine receptor CXCR3 has
also been postulated to mediate the angiostatic activity of the
CXCR3 ligands [3, 7]. Recently, Lasagni et al. discovered a new,
alternatively spliced variant of CXCR3 and claimed that this
so-called CXCR3B and not the classically spliced CXCR3, renamed
CXCR3A, was responsible for the angiostatic activity of these
ligands [12]. Another CXCR3 splicing variant, called CXCR3-alt, was
demonstrated in PBMC as being generated through
post-transcriptional exon skipping [35]. Nevertheless, using three
different primer sets did not allow us to detect any mRNA for these
three CXCR3 variants in primary HMVEC or immortalized HMEC-1 cells.
Various groups have also failed to observe any CXCR3 in their
endothelial cell preparations in vitro [14, 15, 34], despite the
detection of endothelial CXCR3 reported by other groups [7, 20,
22]. Nevertheless, our immunohistochemical analysis of melanoma
sections clearly showed positive CXCR3 staining on endothelial
vessels. Interestingly, for all the angiostatic chemokines known so
far, either no receptor has been found (CXCL14) [9], or they have
been reported to bind at least one of the known human CXCR3
variants. Indeed, Lasagni et al. showed that CXCL4 and the classic
CXCR3 ligands CXCL9, CXCL10 and CXCL11 bind CXCR3B [12]. CXCL13
have been reported to bind human CXCR3 in addition to its classic
receptor, CXCR5, [5, 8], and murine CCL21 (but not human CCL21) is
known to bind CXCR3 and to inhibit angiogenesis in a human lung
cancer SCID mouse model [4, 59]. However, Sulpice et al. claimed
that CXCR3B is probably not responsible for the CXCL4 activity in
HUVEC [10] and no CXCR3B has been reported thus far in mice [3].
Nevertheless, CXCR3 ligands do exhibit angiostatic activity in mice
[3, 11]. Therefore, it cannot be excluded that there exists only
one CXCR3 receptor in mice which is responsible for the inhibition
of vessel growth by all the angiostatic chemokines in mice models.
In humans on the other hand, the angiostatic activity may be
mediated through CXCR3B, through another, not yet identified, CXCR3
variant or through an unknown receptor, possibly with some
similarity to CXCR3.
Acknowledgments
The authors would like to thank Marcus Thelen (Institute for
Research in Biomedicine, Bellinzona, Switzerland) for providing us
with the anti-CXCR7 antibody and Catherine E. Alford (VA Flow
Cytometry Special Resource Center, VA Medical Center, Nashville,
TN, USA) for performing the FACS analysis. This work was supported
by the Career Scientist Award and Merit Award from the Department
of Veterans Affairs (AR), the NCI grant CA34590 (AR), the NIH grant
CA68485 to the Vanderbilt Ingram Cancer Center, the NIH grant SP30
AR1943 to the Skin Disease Research Center, the European Union 6FP
EC contract INNOCHEM (JVD), the InterUniversity Attraction Poles
Initiative of the Belgian Federal Government (JVD) and the Center
of Excellence of the University of Leuven (Credit N° EF/05/15; Rega
Institute). ES is a senior research assistant from the Fund for
Scientific Research of Flanders (FWO-Vlaanderen, Belgium) and MG
holds a postdoctoral fellowship from the Research Fund from the
University of Leuven.
References
1 Thorin E, Shreeve SM. Heterogeneity of vascular
endothelial cells in normal and disease states. Pharmacol Ther
1998; 78: 155.
2 Conway EM, Carmeliet P. The diversity of endothelial
cells: a challenge for therapeutic angiogenesis. Genome Biol 2004;
5: 207.
3 Strieter RM, Burdick MD, Gomperts BN,
Belperio JA, Keane MP. CXC chemokines in angiogenesis.
Cytokine Growth Factor Rev 2005; 16: 593.
4 Murphy PM, Baggiolini M, Charo IF,
Hebert CA, Horuk R, Matsushima K, Miller LH,
Oppenheim JJ, Power CA. International union of
pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol
Rev 2000; 52: 145.
5 Salcedo R, Oppenheim JJ. Role of chemokines in
angiogenesis: CXCL12/SDF-1 and CXCR4 interaction, a key regulator
of endothelial cell responses. Microcirculation 2003; 10: 359.
6 Addison CL, Daniel TO, Burdick MD, Liu H,
Ehlert JE, Xue YY, Buechi L, Walz A,
Richmond A, Strieter RM. The CXC chemokine receptor 2,
CXCR2, is the putative receptor for ELR+ CXC chemokine-induced
angiogenic activity. J Immunol 2000; 165: 5269.
7 Romagnani P, Annunziato F, Lasagni L,
Lazzeri E, Beltrame C, Francalanci M,
Uguccioni M, Galli G, Cosmi L, Maurenzig L,
Baggiolini M, Maggi E, Romagnani S, Serio M.
Cell cycle-dependent expression of CXC chemokine receptor 3 by
endothelial cells mediates angiostatic activity. J Clin Invest
2001; 107: 53.
8 Spinetti G, Camarda G, Bernardini G, Romano Di
Peppe S, Capogrossi MC, Napolitano M. The chemokine
CXCL13 (BCA-1) inhibits FGF-2 effects on endothelial cells. Biochem
Biophys Res Commun 2001; 289: 19.
9 Shellenberger TD, Wang M, Gujrati M,
Jayakumar A, Strieter RM, Burdick MD,
Ioannides CG, Efferson CL, El-Naggar AK,
Roberts D, Clayman GL, Frederick MJ. BRAK/CXCL14 is
a potent inhibitor of angiogenesis and a chemotactic factor for
immature dendritic cells. Cancer Res 2004; 64: 8262.
10 Sulpice E, Contreres JO, Lacour J,
Bryckaert M, Tobelem G. Platelet factor 4 disrupts the
intracellular signalling cascade induced by vascular endothelial
growth factor by both KDR dependent and independent mechanisms. Eur
J Biochem 2004; 271: 3310.
11 Pan J, Burdick MD, Belperio JA, Xue YY,
Gerard C, Sharma S, Dubinett SM, Strieter RM.
CXCR3/CXCR3 ligand biological axis impairs RENCA tumor growth by a
mechanism of immunoangiostasis. J Immunol 2006; 176: 1456.
12 Lasagni L, Francalanci M, Annunziato F,
Lazzeri E, Giannini S, Cosmi L, Sagrinati C,
Mazzinghi B, Orlando C, Maggi E, Marra F,
Romagnani S, Serio M, Romagnani P. An alternatively
spliced variant of CXCR3 mediates the inhibition of endothelial
cell growth induced by IP-10, Mig, and I-TAC, and acts as
functional receptor for platelet factor 4. J Exp Med 2003; 197:
1537.
13 Zhuge X, Murayama T, Arai H, Yamauchi R,
Tanaka M, Shimaoka T, Yonehara S, Kume N,
Yokode M, Kita T. CXCL16 is a novel angiogenic factor for
human umbilical vein endothelial cells. Biochem Biophys Res Commun
2005; 331: 1295.
14 Gupta SK, Lysko PG, Pillarisetti K,
Ohlstein E, Stadel JM. Chemokine receptors in human
endothelial cells. Functional expression of CXCR4 and its
transcriptional regulation by inflammatory cytokines. J Biol Chem
1998; 273: 4282.
15 Murdoch C, Monk PN, Finn A. Cxc chemokine
receptor expression on human endothelial cells. Cytokine 1999; 11:
704.
16 Salcedo R, Wasserman K, Young HA,
Grimm MC, Howard OM, Anver MR, Kleinman HK,
Murphy WJ, Oppenheim JJ. Vascular endothelial growth
factor and basic fibroblast growth factor induce expression of
CXCR4 on human endothelial cells: In vivo neovascularization
induced by stromal-derived factor-1alpha. Am J Pathol 1999; 154:
1125.
17 Bouis D, Hospers GA, Meijer C, Molema G,
Mulder NH. Endothelium in vitro: a review of human vascular
endothelial cell lines for blood vessel-related research.
Angiogenesis 2001; 4: 91.
18 Otto M, Bittinger F, Kriegsmann J,
Kirkpatrick CJ. Differential adhesion of polymorphous
neutrophilic granulocytes to macro- and microvascular endothelial
cells under flow conditions. Pathobiology 2001; 69: 159.
19 Feil C, Augustin HG. Endothelial cells
differentially express functional CXCchemokine receptor-4
(CXCR-4/fusin) under the control of autocrine activity and
exogenous cytokines. Biochem Biophys Res Commun 1998; 247: 38.
20 Salcedo R, Resau JH, Halverson D,
Hudson EA, Dambach M, Powell D, Wasserman K,
Oppenheim JJ. Differential expression and responsiveness of
chemokine receptors (CXCR1-3) by human microvascular endothelial
cells and umbilical vein endothelial cells. FASEB J 2000; 14:
2055.
21 Heidemann J, Ogawa H, Dwinell MB,
Rafiee P, Maaser C, Gockel HR, Otterson MF,
Ota DM, Lugering N, Domschke W, Binion DG.
Angiogenic effects of interleukin 8 (CXCL8) in human intestinal
microvascular endothelial cells are mediated by CXCR2. J Biol Chem
2003; 278: 8508.
22 Hillyer P, Mordelet E, Flynn G, Male D.
Chemokines, chemokine receptors and adhesion molecules on different
human endothelia: discriminating the tissue-specific functions that
affect leucocyte migration. Clin Exp Immunol 2003; 134: 431.
23 Li A, Dubey S, Varney ML, Dave BJ,
Singh RK. IL-8 directly enhanced endothelial cell survival,
proliferation, and matrix metalloproteinases production and
regulated angiogenesis. J Immunol 2003; 170: 3369.
24 Salcedo R, Zhang X, Young HA, Michael N,
Wasserman K, Ma WH, Martins-Green M, Murphy WJ,
Oppenheim JJ. Angiogenic effects of prostaglandin E2 are
mediated by up-regulation of CXCR4 on human microvascular
endothelial cells. Blood 2003; 102: 1966.
25 Yoshida S, Ono M, Shono T, Izumi H,
Ishibashi T, Suzuki H, Kuwano M. Involvement of
interleukin-8, vascular endothelial growth factor, and basic
fibroblast growth factor in tumor necrosis factor alpha-dependent
angiogenesis. Mol Cell Biol 1997; 17: 4015.
26 Yun HJ, Jo DY. Production of stromal cell-derived
factor-1 (SDF-1)and expression of CXCR4 in human bone marrow
endothelial cells. J Korean Med Sci 2003; 18: 679.
27 Balabanian K, Lagane B, Infantino S,
Chow KY, Harriague J, Moepps B. Arenzana- Seisdedos
F, Thelen M, Bachelerie F. The chemokine SDF-1/CXCL12 binds to and
signals through the orphan receptor RDC1 in T lymphocytes. J Biol
Chem 2005; 280: 35760.
28 Mueller SG, Schraw WP, Richmond A. Melanoma
growth stimulatory activity enhances the phosphorylation of the
class II interleukin-8 receptor in non-hematopoietic cells. J Biol
Chem 1994; 269: 1973.
29 Luan J, Shattuck-Brandt R, Haghnegahdar H,
Owen JD, Strieter R, Burdick M, Nirodi C,
Beauchamp D, Johnson KN, Richmond A. Mechanism and
biological significance of constitutive expression of MGSA/GRO
chemokines in malignant melanoma tumor progression. J Leukoc Biol
1997; 62: 588.
30 Infantino S, Moepps B, Thelen M. Expression
and regulation of the orphan receptor RDC1 and its putative ligand
in human dendritic and B cells. J Immunol 2006; 176: 2197.
31 Flynn G, Maru S, Loughlin J, Romero IA,
Male D. Regulation of chemokine receptor expression in human
microglia and astrocytes. J Neuroimmunol 2003; 136: 84.
32 Shimizu N, Soda Y, Kanbe K, Liu HY,
Mukai R, Kitamura T, Hoshino H. A putative G
protein-coupled receptor, RDC1, is a novel coreceptor for human and
simian immunodeficiency viruses. J Virol 2000; 74: 619.
33 Segerer S, Banas B, Wornle M, Schmid H,
Cohen CD, Kretzler M, Mack M, Kiss E,
Nelson PJ, Schlondorff D, Grone HJ. CXCR3 is
involved in tubulointerstitial injury in human glomerulonephritis.
Am J Pathol 2004; 164: 635.
34 Soejima K, Rollins BJ. A functional
IFN-gamma-inducible protein-10/CXCL10- specific receptor expressed
by epithelial and endothelial cells that is neither CXCR3 nor
glycosaminoglycan. J Immunol 2001; 167: 6576.
35 Ehlert JE, Addison CA, Burdick MD,
Kunkel SL, Strieter RM. Identification and partial
characterization of a variant of human CXCR3 generated by
posttranscriptional exon skipping. J Immunol 2004; 173: 6234.
36 Zagzag D, Lukyanov Y, Lan L, Ali MA,
Esencay M, Mendez O, Yee H, Voura EB,
Newcomb EW. Hypoxia-inducible factor 1 and VEGF upregulate
CXCR4 in glioblastoma: implications for angiogenesis and glioma
cell invasion. Lab Invest 2006; 86: 1221.
37 Schioppa T, Uranchimeg B, Saccani A,
Biswas SK, Doni A, Rapisarda A, Bernasconi S,
Saccani S, Nebuloni M, Vago L, Mantovani A,
Melillo G, Sica A. Regulation of the chemokine receptor
CXCR4 by hypoxia. J Exp Med 2003; 198: 1391.
38 Kryczek I, Lange A, Mottram P, Alvarez X,
Cheng P, Hogan M, Moons L, Wei S, Zou L,
Machelon V, Emilie D, Terrassa M, Lackner A,
Curiel TJ, Carmeliet P, Zou W. CXCL12 and vascular
endothelial growth factor synergistically induce neoangiogenesis in
human ovarian cancers. Cancer Res 2005; 65: 465.
39 Qin S, Rottman JB, Myers P, Kassam N,
Weinblatt M, Loetscher M, Koch AE, Moser B,
Mackay CR. The chemokine receptors CXCR3 and CCR5 mark subsets
of T cells associated with certain inflammatory reactions. J Clin
Invest 1998; 101: 746.
40 Brelot A, Heveker N, Montes M, Alizon M.
Identification of residues of CXCR4 critical for human
immunodeficiency virus coreceptor and chemokine receptor
activities. J Biol Chem 2000; 275: 23736.
41 Baribaud F, Edwards TG, Sharron M,
Brelot A, Heveker N, Price K, Mortari F,
Alizon M, Tsang M, Doms RW. Antigenically distinct
conformations of CXCR4. J Virol 2001; 75: 8957.
42 Robledo MM, Bartolome RA, Longo N,
Rodriguez-Frade JM, Mellado M, Longo I, van
Muijen GN, Sanchez-Mateos P, Teixido J. Expression
of functional chemokine receptors CXCR3 and CXCR4 on human melanoma
cells. J Biol Chem 2001; 276: 45098.
43 Zagzag D, Krishnamachary B, Yee H,
Okuyama H, Chiriboga L, Ali MA, Melamed J,
Semenza GL. Stromal cell-derived factor-1alpha and CXCR4
expression in hemangioblastoma and clear cell-renal cell carcinoma:
von Hippel-Lindau loss-offunction induces expression of a ligand
and its receptor. Cancer Res 2005; 65: 6178.
44 Staller P, Sulitkova J, Lisztwan J,
Moch H, Oakeley EJ, Krek W. Chemokine receptor CXCR4
downregulated by von Hippel-Lindau tumour suppressor pVHL. Nature
2003; 425: 307.
45 Salvucci O, Yao L, Villalba S,
Sajewicz A, Pittaluga S, Tosato G. Regulation of
endothelial cell branching morphogenesis by endogenous chemokine
stromal-derived factor-1. Blood 2002; 99: 2703.
46 Guleng B, Tateishi K, Ohta M, Kanai F,
Jazag A, Ijichi H, Tanaka Y, Washida M,
Morikane K, Fukushima Y, Yamori T, Tsuruo T,
Kawabe T, Miyagishi M, Taira K, Sata M,
Omata M. Blockade of the stromal cell-derived factor-1/CXCR4
axis attenuates in vivo tumor growth by inhibiting angiogenesis in
a vascular endothelial growth factorindependent manner. Cancer Res
2005; 65: 5864.
47 Aghi M, Cohen KS, Klein RJ, Scadden DT,
Chiocca EA. Tumor stromal-derived factor-1 recruits vascular
progenitors to mitotic neovasculature, where microenvironment
influences their differentiated phenotypes. Cancer Res 2006; 66:
9054.
48 Takahashi Y, Akishima-Fukasawa Y, Kobayashi N,
Sano T, Kosuge T, Nimura Y, Kanai Y,
Hiraoka N. Prognostic value of tumor architecture,
tumor-associated vascular characteristics, and expression of
angiogenic molecules in pancreatic endocrine tumors. Clin Cancer
Res 2007; 13: 187.
49 Tachibana K, Hirota S, Iizasa H,
Yoshida H, Kawabata K, Kataoka Y, Kitamura Y,
Matsushima K, Yoshida N, Nishikawa S,
Kishimoto T, Nagasawa T. The chemokine receptor CXCR4 is
essential for vascularization of the gastrointestinal tract. Nature
1998; 393: 591.
50 Rempel SA, Dudas S, Ge S, Gutierrez JA.
Identification and localization of the cytokine SDF1 and its
receptor, CXC chemokine receptor 4, to regions of necrosis and
angiogenesis in human glioblastoma. Clin Cancer Res 2000; 6:
102.
51 Ceradini DJ, Kulkarni AR, Callaghan MJ,
Tepper OM, Bastidas N, Kleinman ME, Capla JM,
Galiano RD, Levine JP, Gurtner GC. Progenitor cell
trafficking is regulated by hypoxic gradients through HIF-1
induction of SDF-1. Nat Med 2004; 10: 858.
52 Heidemann J, Ogawa H, Rafiee P,
Lugering N, Maaser C, Domschke W, Binion DG,
Dwinell MB. Mucosal angiogenesis regulation by CXCR4 and its
ligand CXCL12 expressed by human intestinal microvascular
endothelial cells. Am J Physiol Gastrointest Liver Physiol 2004;
286: G1059.
53 Burns JM, Summers BC, Wang Y, Melikian A,
Berahovich R, Miao Z, Penfold ME, Sunshine MJ,
Littman DR, Kuo CJ, Wei K, McMaster BE,
Wright K, Howard MC, Schall TJ. A novel chemokine
receptor for SDF-1 and I-TAC involved in cell survival, cell
adhesion, and tumor development. J Exp Med 2006; 203: 2201.
54 Poole LJ, Yu Y, Kim PS, Zheng QZ,
Pevsner J, Hayward GS. Altered patterns of cellular gene
expression in dermal microvascular endothelial cells infected with
Kaposi’s sarcoma-associated herpesvirus. J Virol 2002; 76:
3395.
55 Madden SL, Cook BP, Nacht M, Weber WD,
Callahan MR, Jiang Y, Dufault MR, Zhang X,
Zhang W, Walter-Yohrling J, Rouleau C,
Akmaev VR, Wang CJ, Cao X, St Martin TB,
Roberts BL, Teicher BA, Klinger KW, Stan RV,
Lucey B, Carson-Walter EB, Laterra J,
Walter KA. Vascular gene expression in nonneoplastic and
malignant brain. Am J Pathol 2004; 165: 601.
56 Ladoux A, Frelin C. Coordinated Up-regulation by
hypoxia of adrenomedullin and one of its putative receptors (RDC-1)
in cells of the rat blood-brain barrier. J Biol Chem 2000; 275:
39914.
57 Bosco MC, Puppo M, Santangelo C,
Anfosso L, Pfeffer U, Fardin P, Battaglia F,
Varesio L. Hypoxia modifies the transcriptome of primary human
monocytes: modulation of novel immune-related genes and
identification of CC-chemokine ligand 20 as a new hypoxia-inducible
gene. J Immunol 2006; 177: 1941.
58 Luster AD, Leder P. IP-10, a -C-X-C- chemokine,
elicits a potent thymus-dependent antitumor response in vivo. J Exp
Med 1993; 178: 1057.
59 Arenberg DA, Zlotnick A, Strom SR,
Burdick MD, Strieter RM. The murine CC chemokine,
6C-kine, inhibits tumor growth and angiogenesis in a human lung
cancer SCID mouse model. Cancer Immunol Immunother 2001; 49:
587.
|