ARTICLE
Auteur(s) : Kaouther Snoussi1, A Donny
Strosberg2, Noureddine Bouaouina1,3, Slim Ben
Ahmed4, Lotfi
Chouchane1
1Laboratoire d’Immuno-Oncologie Moléculaire, Faculté
de Médecine de Monastir, Université de Monastir, 5019 Monastir,
Tunisia
2Department of Infectology, Scripps-Florida USA
3Department of Cancérologie Radiothérapie CHU Farhat
Hached, Sousse, Tunisia
4Service de Carcinologie Médicale, CHU Farhat Hached,
Sousse, Tunisia
The role of genetic factors in the epidemiology and pathogenesis of
both sporadic breast carcinoma and hereditary breast carcinoma are
now well established [1, 2]. Only a small minority (± 5%) of
patients with breast carcinoma develop the disease as a result of
inheritance of germline mutations in dominant, highly penetrant
susceptibility genes such as BRCA1 and BRCA2. However,
polymorphisms in genes involved in the complex mechanisms of
carcinogenesis may confer low penetrant susceptibility to breast
carcinoma in a significant proportion of the remainder of patients
[2-4].Multifunctional cytokines, interleukin-1 (IL-1) and
interleukin-6 (IL-6), are involved in the development of
inflammatory and immunological responses which play a crucial role
in the pathogenesis of autoimmune and malignant diseases.The IL-1
gene cluster on chromosome 2q14.2 contains three related genes
within a 430 kb region: IL-1α, IL-1β, and IL-RN, which encode the
pro-inflammatory cytokines IL-1α, IL-1β as well as their endogenous
receptor antagonist IL-1ra, respectively [5]. These cytokines are
produced by a variety of cell types, including monocytes,
macrophages, and epithelial cells and have multiple biological
effects [6]. The role of IL-1 in carcinogenesis has been
investigated extensively. Experimental data support the crucial
role for these cytokines as autocrine or paracrine stimuli in
murine and human carcinogenesis [7-9].In breast carcinoma, secreted
IL-1α of tumor cell origin was shown to induce expression of
prometastasic genes in the malignant cells (IL-6 and IL-8) and in
stromal fibroblasts (IL-6, IL-8 and MMP-3), in an autocrine and
paracrine manner, respectively [10]. IL-1β was found to combine
with oestrogen receptor (ER)α, resulting in transcriptional
activation in breast cancer cells [11]. The concentration of IL-1β
was reported to be higher in invasive breast carcinoma tissue than
in benign lesions [12].Several polymorphisms have been reported for
the three IL-1 members [13, 14]. Among those, IL1-A (-889) C-T and
IL1-B (+3954) C-T are reported to be functional [14, 15]. The
polymorphism (-889) C-T of IL-1α corresponds with altered IL-1α
protein expression in vivo and in vitro, the presence of the T
allele has been associated with increased IL-1α secretion [15,
16].The polymorphism at position +3954 in exon 5 of the IL-1β gene,
has been widely investigated for its effect on protein production.
The presence of the T allele at this site has been associated with
increased IL-1β secretion in vitro [14]. IL1-B polymorphisms have
been reported to be associated with pancreatic cancer risk
[17].IL-6 is another pleiotropic pro-inflammatory cytokine that may
be involved in the host response to cancer. Experimental findings
suggest that IL-6 acts as a potent stimulator of metastasis by
up-regulating the expression on endothelial cells of adhesion
receptors, such as intercellular adhesion molecule-1 and leukocyte
adhesion molecule-1, and also by stimulating the production of
growth factors such as hepatocyte growth factor and vascular
endothelial growth factor [18-20].The status of common functional
single G>A and G>C base exchange polymorphisms in the human
IL-6 gene promoter (chromosome 7p21) located respectively at 597
and 174, upstream from the start site of transcription (-597 G>A
and -174 G>C loci), have been reported to influence IL-6 levels
in vitro and in vivo [21-23]. The G alleles at (-597) or (-174)
increases IL-6 expression, both in basal and stimulated conditions,
the highest IL-6 levels in plasma and serum being found in subjects
homozygous for the (-597 or -174) G allele [21, 22].Results of
subsequent studies of the association of IL-6 (-174) G/C
polymorphism with a biological phenotype of breast cancer have been
controversial. In the Australian population, the IL-6 (-174) CC
genotype was associated with an aggressive form of breast cancer
[24]. In a British study, the heterozygous genotype (GC) of this
polymorphism was associated with markers of poor prognosis [25].
However, in the American population, the proposed associations have
not been confirmed [26].Based on the abundant evidence for the role
of IL-1 and IL-6 in carcinogenesis and the known correlation
between polymorphisms of the IL-1α, IL-1β and IL-6 and protein
expression, we investigated the potential association of these
polymorphisms with the susceptibility, clinicopathological
characteristics and prognosis of breast carcinoma.
Materials and methods
Patients and controls
The gene and allele frequencies of the genes for IL-1α, IL-1β and
IL-6 were determined in a group of 200, unrelated, control subjects
and 305, unrelated patients with breast carcinoma. The control and
patient groups were selected from the same population, living on
the coast of Tunisia.
Clinical follow-up data were collected in the cohort of the 305
patients recruited from the department of Radiation Oncology and
Medical Oncology of Sousse Hospital (Sousse, Tunisia) between 1991
and 2003.
All patients included in this study had primary breast
carcinoma, with unilateral breast tumors. The patients (301 females
and 4 males) had a mean age of 50 ± 24 years. The median of
follow-up was 36 months (range, 1-120 months). At the time of
analysis, 65 patients experienced recurrence (local or distant).
Among them, 18 patients died from breast carcinoma (27.7%). A
detailed description of the clinicopathological characteristics of
this cohort has been reported elsewhere [27]. Table 1( Table 1 ) shows the treatment description of all
patients.
Control subjects (191 females and 9 males) having a mean age of
46 ± 12 years, were healthy blood donors, having no evidence of any
personal or family history of cancer (or other serious illnesses).
Written informed consent was obtained from all subjects.
Table 1 Treatment description of the 305 patients with
breast carcinoma
|
Surgery
|
No surgery
|
|
Radiotherapy
|
33
|
16
|
|
Chemotherapy
|
23
|
17
|
|
Radiotherapy + Chemotherapy
|
133
|
25
|
|
Radiotherapy + endocrine therapy
|
14
|
0
|
|
Chemotherapy + endocrine therapy
|
6
|
6
|
|
Radiotherapy + Chemotherapy + endocrine therapy
|
32
|
0
|
Genomic DNA extraction
Genomic DNA was extracted from peripheral blood leukocytes by a
salting procedure [28]. Briefly, 10 mL of blood were mixed
with triton lysis buffer (0.32M sucrose, 1% Triton X-100, 5mM
MgCl2, H2O, 10mM Tris-HCl, PH 7.5).
Leukocytes were spun down and washed with H2O. The
pellet was incubated with proteinase K at 56°C and subsequently
salted out at 4°C using a substrate NaCl solution. Precipitated
proteins were moved by centrifugation. The DNA in supernatant fluid
was precipitated with ethanol. The DNA pellet was dissolved in 400
μl H2O.
Polymorphism analysis of the IL-1α gene
Based upon the method described by Tarra et al. [29], a polymerase
chain reaction (PCR), followed by digestion with the endonuclease
NcoI was used to detect the C to T transition polymorphism at
position -889 of IL-1α gene. Two sequence specific oligonucleotide
primers were used for the PCR: the 3’-primer (5’-
GGGGGCTTCACTATGTTGCCCACACTGGACTAA - 3’) was used with the 5’-primer
(5’- GAAGGCATGGATTTTTACATATGACCTTCCATG - 3’). Thirty microliters of
PCR reaction mixture comprised genomic DNA samples (100ng), 200
μmol/L dNTPs, 1.5 mM MgCl2, 1x Taq polymerase buffer, 50
pmol of each primer, and 0.5 unit of Taq DNA polymerase (Amersham,
Paris, France). Reaction conditions used with the thermal cycler
(Biometra, GÖttingem, Germany) were as follows: an initial
incubation at 94°C for 4 minutes, followed by 30 cycles of
incubation at 94°C for 30 seconds, 50°C for 30 seconds and 72°C for
30 seconds and followed by a final incubation at 72°C for 5
minutes. The amplified fragments (300 bp) were digested with NcoI,
fragments were analysed by agarose-gel electrophoresis. The T
allele remained uncut, while the C allele was cut into 2 fragments
of 280 and 20 bp.
Polymorphism analysis of the IL-1β gene
A 249 bp fragment of the fifth exon encoding IL-1β (position +3816
to 4066) was amplified using the following specific oligonucleotide
primers: the 5’ primer: 5’-GTTGTCATCAGACTTTGACC-3’ was used in
combination with the 3’ primer: 5’- TTCAGTTCATATGGACCAGA -3’ in a
25 μL reaction mixture containing genomic DNA samples (100ng), 200
μmol/L dNTPs, 1.5 mM MgCl2, 1x Taq polymerase buffer, 50
pmol of each primer, and 0.5 unit of Taq DNA polymerase (Amersham,
France). Amplification was accomplished by initial incubation at
96°C for 5 minutes followed by 3 cycles of 96°C for 90 seconds,
53°C for 90 seconds; 35 cycles of 96°C for 60 seconds, 53°C for 60
seconds, 72°C for 60 seconds respectively, and a final extension at
72°C for 10 minutes.
To assess the polymorphism of the IL-1β at position 3954, the
corresponding PCR products were digested with TaqI. The presence of
a TaqI site, which corresponds to the C allele, was indicated by
the cleavage of the 249 bp amplified product to yield fragments of
135 and 114 bp. The T allele corresponds to the uncut fragment.
Polymorphism analysis of the IL-6 gene
The two polymorphic sites (-174 and -597) of the promoter of IL-6
gene were analyzed. A 198 bp fragment covering the (-174)
polymorphic site of the IL-6 gene was amplified using the following
primers: 5’- TGACTTCAGCTTTACT CTTTGT - 3’ and 5’-
CTGATTGGAAACCTTATTAAG - 3’ in a 20 μl reaction mixture containing
genomic DNA samples (100ng), 200 μmol/L dNTPs, 1.5 mM
MgCl2, 1x Taq polymerase buffer, 0.5 μmol/L of each
primer, and 0.5 unit of Taq DNA polymerase (Amersham, France). PCR
amplification were performed with an initial denaturation
temperature of 94°C for 10 minutes, followed by 35 cycles of 96°C
for 60 seconds, 55°C for 60 seconds, and 72°C for 60 seconds, and a
final extension at 72°C for 10 minutes.
PCR products were digested with NlaIII restriction enzyme at
37°C overnight and electrophoresed on a 2% agarose gel. NlaIII RFLP
was detected by ethidium bromide staining. The presence of an
NlaIII site was indicated by the cleavage of the 198 bp amplified
product to yield 140 bp and 58 bp. The G allele corresponds to the
uncut fragment and the C allele to the presence of NlaIII site.
The analysis of the (-597 G/A) polymorphism of the IL-6 gene was
performed using the following primers 5’- GGAGACGCCTTGAAGTAACTGC -
3’ and 5’-GAGTTTCCTCTGACTCCATC - 3’ to generate a PCR fragment of
163 bp. Genotyping was resolved by PCR product digestion with the
FokI enzyme. The rare IL-6 (-597) A allele has a FokI restriction
cutting site. The resulting fragments have the size of 116 and 47
bp.
To assess genotyping reliability PCR products for the IL-1α,
IL-1β and IL-6 polymorphisms were analyzed by direct
sequencing.
Statistical analyses
The allele frequencies of IL-1α, IL-1β or IL-6 were tested for the
Hardy-Weinberg equilibrium for both patient and control groups
using the Chi-Square test. The same test was used to evaluate for
significant association between disease (breast carcinoma against
controls) and IL-1α, IL-1β or IL-6 genotypes. Relative risk of
breast carcinoma associated with a particular genotype was
estimated by the odds ratio (OR).
Disease-free survival (DFS) was defined as the time from the
date of diagnosis to the first local or distant recurrence or to
last contact. Breast carcinoma-specific overall survival (OVS) was
defined as the time from the date of diagnosis to death if the
patient died from breast carcinoma or to last contact. Six-year
survival rates were estimated, and survival curves were plotted
according to Kaplan and Meier [30]. Differences between groups were
calculated by the log rank test [31]. Clinicopathological
parameters were dichotomized as follows: nodal status (≥1 versus no
positive lymph node), SBR (Scarff, Bloom and Richardson) tumor
grade (1-2 versus 3), clinical tumor size
(T1-T2 versus T3-T4).
Statistics were performed using SEM-STATISTIQUES software (Centre
Jean Perrin, Clermont-Ferrand, France).
Results
Polymorphisms in the IL-1α, IL-1β and IL-6 genes as risk
factors for breast carcinoma
Table 2( Table 2 ) shows genotype
frequencies for IL-1α, IL-1β and IL-6 in patients with breast
carcinoma and in the control group. The genotype distributions of
IL-1α, IL-1β and IL-6 genes were in Hardy-Weinberg equilibrium for
both patient and control groups.
No significant differences in IL-1α genotype distribution were
seen between the patients and controls. The frequency of the IL-1β
(+3954) TT homozygous genotype was higher in the patient group than
in the control subjects, but the difference reached only borderline
significance (0.111 versus 0.070, OR = 1.86, p = 0.06).
A significant increase in the frequency of the IL-6 (-597) GA
heterozygous genotype was observed in the patient group compared to
the control group (0.324 versus 0.235, OR = 1.59, p = 0.024).
The frequency of the IL-6 (-174) GC heterozygous genotype was
also higher in patients than in controls (0.321 versus 0.230, OR =
1.61, p = 0.022). In agreement with a previous report [32], the two
polymorphisms were found in tight linkage disequilibrium.
Table 2 IL-1α, IL-1β and IL-6 genotypes frequencies in
control subjects and in patients with breast carcinoma
|
Genotype
|
Patients
|
Controls
|
OR
|
Confidence interval
|
p-value
|
|
n = 305
|
n = 200
|
|
|
|
|
n
|
f
|
n
|
f
|
|
|
|
|
(-889) IL-1 α
|
|
|
|
|
|
|
|
|
C/C
|
116
|
(0.380)
|
83
|
(0.415)
|
1
|
|
|
|
C/T
|
132
|
(0.433)
|
82
|
(0.410)
|
1.15
|
[0.76-1.74]
|
NS
|
|
T/T
|
57
|
(0.187)
|
35
|
(0.175)
|
1.17
|
[0.68-2]
|
NS
|
|
(+3954) IL-1β
|
|
|
|
|
|
|
|
|
C/C
|
157
|
(0.515)
|
120
|
(0.60)
|
1
|
|
|
|
C/T
|
114
|
(0.374)
|
66
|
(0.330)
|
1.32
|
[0.88-1.98]
|
NS
|
|
T/T
|
34
|
(0.111)
|
14
|
(0.070)
|
1.86
|
[0.91-3.82]
|
0.06
|
|
(-597) IL-6
|
|
|
|
|
|
|
|
|
G/G
|
197
|
(0.646)
|
149
|
(0.745)
|
1
|
|
|
|
G/C
|
99
|
(0.324)
|
47
|
(0.235)
|
1.59
|
[1.04-2.44]
|
0.024
|
|
C/C
|
09
|
(0.030)
|
04
|
(0.020)
|
1.70
|
[0.47-6.70]
|
NS
|
|
(-174) IL-6
|
|
|
|
|
|
|
|
|
G/G
|
199
|
(0.653)
|
150
|
(0.750)
|
1
|
|
|
|
G/C
|
98
|
(0.321)
|
46
|
(0.230)
|
1.61
|
[1.05-2.47]
|
0.022
|
|
C/C
|
08
|
(0.026)
|
04
|
(0.020)
|
1.51
|
[0.40-6.07]
|
NS
|
Prognostic significance of polymorphisms in the IL-1α, IL-1β
and IL-6 genes
Table 3( Table 3 ) shows the
distributions of IL-1α, IL-1β and IL-6 polymorphisms according to
the clinicopathological indices of breast carcinoma severity. The T
(+3954) allele of the IL-1β gene was found in 63.75% of patients
with large tumors (T3-T4). The same allele was found in 66.66% of
patients having tumors with high SBR tumor grade (grade 3). In
addition, the T (+3954) allele was found in 61.11% of patients with
lymph node metastases. Taken together, these results suggest that
the T (+3954) allele of the IL-1β gene is highly associated with
the aggressive forms of breast carcinoma.
( Figure 1 )
shows breast carcinoma-specific overall survival (OVS) and
disease-free survival (DFS) in patients according to the presence
or absence of the IL-1α (-889) TT homozygous genotype. The
estimated 3- and 6-year breast carcinoma-specific OVS rate in the
group of patients carrying or not carrying the IL-1α (-889) TT
homozygous genotype was, respectively, 75% and 36.8% versus 94.9%
and 70.6% (log rank test, p < 0.01). The 3-year DFS rate in the
group of patients with IL-1α (-889) TT genotype was 80.9% and 98.5%
in the group of patients without IL-1α (-889) TT genotype (log rank
test, p < 10-5).
A remarkably strong association between DFS and IL-1β (+3954) TT
genotype was found in all the 305 patients (( figure 2 )). The
estimated 3-year DFS rate in the group of patients with IL-1β
(+3954) TT genotype was 79.4% and 98.5% in the group of patients
without the IL-1β (+3954) TT marker (log rank test, p <
10-3). No statistical difference in the OVS was observed
between the two groups of patients.
As shown in ( figure
3 ), the breast carcinoma-specific DFS was significantly
shorter in the group of patient with the IL-6 (-597) GG and IL-6
(-174) GG genotypes. The estimated 3-year DFS rate in the groups of
patients with (-597) GG or (-174) GG genotypes was 92% and 99% in
that of patients without IL-6 (-597) GG or (-174) GG markers (log
rank test, p < 0.02). No association was found between IL-6
(-597) GG and IL-6 (-174) GG genotypes and the OVS rate in this
population of patients with breast carcinoma (data not shown).
Multivariate analyses were undertaken to evaluate the importance
of IL-1 and IL-6 markers in the risk of the recurrence and death
compared with the clinicopathological parameters. Introducing the
genetic and clinicopathological parameters bearing prognostic
significance tested the Cox model. No genetic or
clinicopathological parameters were selected for OVS and DFS.
Table 3 Genotype frequencies of IL-1α, IL-1β and IL-6
polymorphisms in relation to pathological indices of breast cancer
severity
|
n (%)
|
p value
|
|
IL-1α-889 polymorphism
|
C/C
|
C/T +T/T
|
|
|
Tumor size
|
|
|
|
|
T1-T2
|
72 (38.1)
|
117 (61.9)
|
0.83
|
|
T3-T4
|
29 (36.7)
|
50 (63.3)
|
|
|
Histological grade
|
|
|
|
|
1-2
|
62 (36.26)
|
109 (63.74)
|
0.9
|
|
3
|
30 (37.03)
|
51 (62.97)
|
|
|
Lymph node metastases
|
|
|
|
|
Negative
|
59 (41.85)
|
82 (58.15)
|
0.19
|
|
Positive
|
56 (34.57)
|
106 (65.43)
|
|
|
IL-1β+3954 polymorphism
|
C/C
|
C/T +T/T
|
|
|
Tumor size
|
|
|
|
|
T1-T2
|
111 (58.73)
|
78 (41.27)
|
0.0007
|
|
T3-T4
|
29 (36.25)
|
51 (63.75)
|
|
|
Histological grade
|
|
|
|
|
1-2
|
99 (57.9)
|
72 (42.10)
|
0.0002
|
|
3
|
27 (33.33)
|
54 (66.66)
|
|
|
Lymph node metastases
|
|
|
|
|
Negative
|
93 (65.96)
|
48 (34.04)
|
0.000002
|
|
Positive
|
63 (38.89)
|
99 (61.11)
|
|
|
IL-6 -597 polymorphism
|
G/G
|
G/A +A/A
|
|
|
Tumor size
|
|
|
|
|
T1-T2
|
117 (61.9)
|
72 (38.1)
|
0.18
|
|
T3-T4
|
55 (70.51)
|
23 (29.49)
|
|
|
Histological grade
|
|
|
|
|
1-2
|
110 (63.95)
|
62 (36.05)
|
0.45
|
|
3
|
55 (68.75)
|
25 (31.25)
|
|
|
Lymph node metastases
|
|
|
|
|
Negative
|
93 (65.49)
|
49 (34.51)
|
0.75
|
|
Positive
|
102 (63.75)
|
58 (36.25)
|
|
|
IL-6 -174 polymorphism
|
G/G
|
G/C+C/C
|
|
|
Tumor size
|
|
|
|
|
T1-T2
|
117 (62.23)
|
71 (37.77)
|
0.07
|
|
T3-T4
|
58 (73.41)
|
21 (26.59)
|
|
|
Histological grade
|
|
|
|
|
1-2
|
111 (64.91)
|
60 (35.09)
|
0.31
|
|
3
|
57 (71.25)
|
23 (28.75)
|
|
|
Lymph node metastases
|
|
|
|
|
Negative
|
91 (64.54)
|
50 (35.46)
|
0.81
|
|
Positive
|
106 (65.84)
|
55 (34.16)
|
|
Discussion
Given the important role of IL-1 and IL-6 in cancer pathogenesis,
IL-1α, IL-1β and IL-6 can be regarded as candidate genes for
cancer.
The present case-controlled study revealed no significant
differences in IL-1α and IL-1β genotype distributions between
patients with breast carcinoma and the control subjects. These
results suggest that these genetic variations in IL-1α and -B are
unlikely to play an important role in the genetic predisposition to
breast carcinoma. In the Tunisian population, the frequency of
IL-1α (-889) TT genotype (17.5%) was higher compared to Italian
(2.8%) and the American (11.8%) populations [33].
The assessment of the prognostic value of the genetic markers
IL-1α and –B in breast carcinoma indicated that the IL-1α (-889) TT
homozygous genotype is associated with reduced overall and
disease-free survival, and therefore with a poor prognosis in
breast carcinoma.
The IL-1β (+3954) TT homozygous genotype was specifically
associated with reduced DFS but not with OVS. More interestingly,
we showed that the (+3954) T allele was highly associated with
aggressive forms of breast carcinoma as defined by large tumor
size, high grade and lymph node metastases.
Several studies have shown that IL-1β promotes invasiveness,
including tumor angiogenesis and also induces immune suppression in
the host [34]. Moreover, IL-1β is expressed in 90% of invasive
breast carcinoma and to lesser extent in ductal, in situ breast
carcinoma and benign lesions [12]. In advanced breast carcinomas,
high IL-1β correlated well with other parameters of aggressive
tumors (high tumor grade, presence of p53, absence of bcl2), and
expression of other pro-inflammatory cytokines such as IL-8 [12,
35].
Most studies indicate that IL-1α production by tumor cells
increases invasiveness [36-38]; only rarely were anti-tumor effects
observed [39]. In breast cancer cell lines and in malignant breast
tumors, expression of IL-1α is associated with both a more
malignant phenotype and ERα negativity [37]. Additionally, it has
been shown that IL-α promotes tumor growth and cachexia in the
MCF-7 xenograft model of breast cancer [38].
Our findings, which show the strong association between IL-1α
and -B gene polymorphisms and the poor prognosis in breast
carcinoma, along with those showing that these genetic variations
in the IL-1 genes are functionally important elements influencing
IL-1 production [10-12], suggest that the genetic basis of the
potential tumor promoter role attributed to IL-1 may result from
IL-1α and -B polymorphisms. Therefore, these polymorphisms could be
causal, predisposing to a poor prognosis in breast carcinoma.
The genotype frequencies of IL-6 determined for the current
cohort indicated a significant increase of IL-6 (-597) GA and –
(-174) GC heterozygous genotypes in patients with breast carcinoma
compared to controls. The frequency of the IL-6 (-597) A and (-174)
C alleles was higher in the patient group compared to the controls,
but the differences did not reach statistical significance. It has
been reported that the polymorphisms of cytokine genes differ
considerably among different populations, particularly
polymorphisms in the IL-6 gene. In the Tunisian population, we
showed that the frequencies of the IL-6 (-597) A and IL-6 (-174) C
alleles are lower compared to other populations: (13% versus 35%).
Our data provided evidence of an association between the IL-6
(-597) GA and IL-6 (-174) GC genotypes and an increased risk of
breast cancer in the Tunisian population, but not with the IL-6
(-597) A or IL-6 (-174) C alleles; this was probably because of the
low number of IL-6 (-597) AA and IL-6 (-174) CC patients in the
Tunisian population.
IL-6 is a pleiotropic cytokine that has been shown to be
important in the activation of the host anti-tumor response. In
vitro studies have shown that IL-6 acts as a late-acting killer
factor (KHF) in the differentiation of cytotoxic T-lymphocytes, and
it augments the activities of NK-cells [40]. Low expression of IL-6
can affect the immune system.
Several studies have shown that the IL-6 (-597) G-A and (-174)
G-C SNPs are functional alterations that affect serum levels of
IL-6 [21, 32]. Recent data from Belluco et al. demonstrate that
circulating IL-6 levels are significantly higher in IL-6 (-174) GG
homozygotes with colon cancer compared with carriers of a C allele
[40]. Thus, we hypothesized that carriage of the mutant IL-6 allele
influences the genetic susceptibility to breast carcinoma.
More interestingly, we showed that the IL-6 GG genotype
homozygous for both positions, known to be genetic factors
dictating the over-production of IL-6, are associated with reduced
disease-free survival. Recently it has been reported that the IL-6
(-174) G allele is significantly associated with increased risk of
recurrence compared with those of the C allele in patients with
high risk, node-positive breast cancer [26]. This result is in
agreement with our findings.
Several reports highlighted the role of IL-6 in cancer
pathogenesis and disease progression. It has been shown that in
different tumor types, a high IL-6 serum level is associated with
advanced stage disease [41-44] and a worse outcome [41, 42, 45,
46]. Regarding breast carcinoma, it has been reported that a high
IL-6 serum level is associated with poor response to cancer therapy
and reduced survival [47-49].
The results of the current study, which show the association
between the IL-6 polymorphisms and both susceptibility and
disease-free survival associated with breast carcinoma, suggest the
genetic basis for the various roles of IL-6 in tumor development,
and clinical outcome may result from IL-6 polymorphisms.
In conclusion, this study suggests that variation in genes for
IL-1 and IL-6 represent attractive factors for the prognosis of
breast carcinoma. The role of the pro-inflammatory cytokines as
genetic markers of breast cancer can be complemented with other
SNPs and haplotype analysis. Extension of the findings of the
current study to other malignant tumors will be of use in
determining whether these genetic markers are specific to breast
carcinoma.
Acknowledgements
We gratefully acknowledge the technical assistance of S. Gabbouj.
We thank the staff of the Departments of Radiation Oncology and
Medical Oncology of CHU F. Hached, Sousse, for providing samples
and clinical information.
References
1 Greene MH. Genetics of breast cancer. Mayo Clin Proc
1997 ; 72 : 54.
2 Dunning AM, Healey CS, Pharoah PD, et al.
A systematic review of genetic polymorphisms and breast cancer
risk. Cancer Epidemiol Biomarkers Prev 1997 ; 8 :
843.
3 Coughlin SS, Piper M. Genetic polymorphisms and risk
of breast cancer. Cancer Epidemiol Biomarkers Prev 1999 ;
8 : 1023.
4 Weber BL, Nathanson KL. Low penetrance genes
associated increased risk for breast cancer. Eur J Cancer
2000 ; 36 : 1193.
5 Taylor SL, Renshaw BR, Garka KE, et al.
Genomics organization of the interleukin-1 locus. Genomics
2002 ; 79 : 726.
6 Dinarello CA. Biologic basis for interleukin-1 in
disease. Blood 1996 ; 87 : 2095.
7 Apte RN, Douvdevani A, Zoller M, White RM,
Dvorkin T, Shimoni N, Fima E, Hachamj M,
Huleilhel M, Benharroch D. Cytokine-induced tumor
immunogenecity : endogenous interleukin-1 alpha expressed by
fibrosarcoma cells confers reduced tumorigenecity. Immunol Lett
1993 ; 39 : 45.
8 Castrilli G, Tatone D, Diodoro MG,
Rosini S, Piantelli M, Musiani P. Interleukin-1α and
interleukin-6 promote the in vitro growth of both normal and
neoplastic human cervical epithelial cells. Br J Cancer 1997 ;
75 : 855.
9 Glaccum MB, Stocking KL, Charrier K,
Smith JL, Willis CR, Maliszewski C,
Livingston DJ, Peschon JJ, Morrisey PJ. Phenotypic
and functional characterization of mice that lack the type I
receptor for IL-1. J Immunol 1997 ; 159 : 3364.
10 Nozaki S, Sledge GWJR, Nakshatris H. Cancer
cell-derived interleukin 1 α contributes to autocrine and paracrine
induction of pro-metastatic genes in breast cancer. Biochem Biophys
Res Commun 2000 ; 275 : 60.
11 Speirs V, Kerin MJ, Newton CJ, Walton DS,
Green AR, Desai SB. Evidence for transcriptional
activation of ERα by IL-1β in breast cancer cells. Int J Oncol
1999 ; 15 : 1251.
12 Jin L, Yuan RQ, Fuchs A, Yao Y,
Joseph A, Schwall R. Expression of interleukin-1β in
human breast carcinoma. Cancer 1997 ; 80 : 421.
13 Bailly S, di Giovine FS, Blakemore AIF,
Duff GW. Genetic polymorphism of human Interleukin1 α. Eur J
Immunol 1993 ; 23 : 1240.
14 Pociot F, Molvig J, Wogensen L,
Worsaae H, Neup JA. TaqI polymorphism in the human
interleukin1-beta (IL-1βeta) gene correlates with IL-1 beta
secretion in vitro. Eur J Clin Invest 1992 ; 22 :
396.
15 Shirodaria S, Smith J, McKay IJ,
Kennett CN, Hughes FJ. Polymorphisms in the IL-1α gene
are correlated with levels of interleukin-1 alpha protein in
gingival crevicular fluid of teeth with severe periodontal disease.
J Dent Res 2000 ; 79 : 1864.
16 Dominici R, Cattaneo M, Malferrari G,
Archi D, Mariani C, Grimaldi LM. Cloning and
functional analysis of the allelic polymorphism in the
transcription regulatory region of interleukin-1 alpha.
Immunogenetics 2002 ; 54 : 82.
17 Barber MD, Powell JJ, Lynch SF,
Fearson KC, Ross JA. A polymorphism of interleukin-1 beta
gene influences survival in pancreatic cancer. Br J Cancer
2000 ; 83 : 1443.
18 Hutchins D, Steel CM. Regulation of ICAM-1 (CD54)
expression in human breast cancer cell lines by interleukin 6 and
fibroblast-derived factors. Int J Cancer 1994 ; 58 :
80.
19 De Jong KP, van Gameren M, Bijzet E,
Limburg PC, Sluiter WJ, Slooff JH, de
Vries EGE. Recombinant human interleukin-6 induces hepatocyte
growth factor production in cancer patients. Scand J Gastroentero
2001 ; 36 : 636.
20 Cohen T, Nahari D, Cerem LW, Neufeld G,
Levi BZ. Interleukin- 6 induces expression of vascular
endothelial growth factor. J Biol Chem 1996 ; 271 :
736.
21 Gemma V, José L, San M, José S,
Héctor F. The -597 G/A and -174 G/C Polymorphisms in the
Promoter of the IL-6 Are Associated with Hyperandrogenism. J Clin
Endocrinol Metab 2002 ; 87 : 1134.
22 Fishman D, Faulds G, Jeffery R,
Mohammed-Ali V, Yudkin JS, Humphries S, Woo P.
The effect of novel polymorphism in the interleukin-6 (IL-6) gene
on IL-6 transcription and serum levels, and association with
systemic-onset juvenile chronic arthritis. J Clin Investig
1998 ; 102 : 1369.
23 Bonafe M, Olivieri F, Cavallone L,
Giovagnetti S, Marchegiani F, Cardelli M,
Pieri C, Marra M, Antonicelli R, Lisa R,
Rizzo MR, Paolisso G, Monti D, Franceshi CA.
Gender-dependent genetic predisposition to produce high levels of
IL-6 is determinal for longevity. Eur J Immunol 2001 ;
31 : 2357.
24 Iacopetta B, Grieu F, Joseph D. The -174 G/C
gene polymorphism in interleukin-6 is associated with aggressive
breast cancer phenotype. Br J Cancer 2004 ; 90 : 419.
25 Smith KC, Bateman AC, Fussell HM,
Howell WM. Cytokine gene polymorphisms and breast cancer
susceptibility and prognosis. Eur J Immunogent 2004 ;
31 : 167.
26 DeMichele A, Martin AM, Mick R, Gor P,
Wray L, Klein-Carbal M, Athanasiadis G,
Collingan T, Stadtmauer E, Weber B. Interleukin-6
-174 G→C Polymorphism Is Associated with Improved Outcome in High
risk Breast Cancer. Cancer Res 2003 ; 63 : 8051.
27 Ben Ahmed S, Aloulou S, Bibi M,
Landolsi A, Nouira M, Ben Fatma L, Kallel L,
Gharbi O, Khairi H, Kraiem C. Breast cancer
detection in Tunisian women : an analysis of a hospital trial
involving 729 patients. Sante Publique (Bucur) 2002 ;
14 : 231.
28 Olerup O, Zetterquiest H. HLA-DR typing by PCR
amplification with sequence specific primers (PCR-SSP) in two
hours : an alternative to serological DR typing in clinical
practice including donor recipient matching in cadaveric
transplantation. Tissue Antigens 1992 ; 39 : 225.
29 Tarra L, Mcdowell JA, Symons RP,
Øystein F, Gordon WD. A Genetic Association between
Juvenile Rheumatoid Arthritis and a Novel Interleukin-1 α
Polymorphism. Arthritis Rheum 1995 ; 38 : 221.
30 Kaplan EL, Meir PO. Nonparametric estimation from
incomplete observations. J Am Stat Assoc 1958 ; 53 :
457.
31 Peto R, Pike MC, Armitage P, Breslow NE,
Cox DR, Howard SV, Mantel N, McPherson K,
Peto J, Smith PG. Design and analysis of randomised
clinical trials requiring prolonged observation of each patient. Br
J Cancer 1977 ; 35 : 1.
32 Brull DJ, Montgomery J, Sanders S,
Dhamrait L, Luong L, Rumley A, Lowe GDO,
Humphries S. Interleukin-6 Gene -174G>C and -572 G>C
Promoter Polymorphisms are strong predictors of plasma
interleukin-6 levels after coronary artery bypass surgery.
Arterioscler Thomb Vasc 2001 ; 21 : 1458 ;
(Biol).
33 Seripa D, Matera MG, Dal Forno G,
Gravina C, Masullo C, Daniele A, Binetti G,
Bonvicini C, Squitti R, Palermo MT, Davis DG,
Antuono P, Wekstein DR, Dobrina A,
Gennarelli M, Fazio VM. Genotypes and haplotypes in the
IL-1 gene cluster : analysis of two genetically and
diagnostically distinct groups of Alzheimer patients. Neurobiol
Aging 2005 ; 26 : 455.
34 Song X, Vornov E, Dvorkin T, Fima E,
Cagnano E, Benharroch D, Shendler Y,
Bjorkdahl O, Segal S, Dinarello CC, Apte RN.
Differential effects of IL-1 alpha and IL-1 beta on tumorigenecity
patterns and invasiveness. J Immunol 2003 ; 15 :
6448.
35 Miller LJ, Kurtzman SH, Anderson K,
Wang Y, Stankus M, Renna M, Linfquist R,
Barrows J, Kreutzer DL. Interleukin-1 family expression
in human breast cancer : interleukin-1 receptor antagonist.
Cancer Invest 2000 ; 18 : 293.
36 Furuya Y, Ichikura T, Mochizuki H.
Interleukin-1 alpha concentration in tumors as a risk factor for
liver metastasis in gastric cancer. Surg Today 1999 ;
29 : 288.
37 Singer C, Kronsteiner N, Hudelist G,
Marton E, Walter I, Kubista M, Czerwenka K,
Shreiber M, Seifert M, Kubista E. Interleukin-1
system and sex steroid receptor expression in human breast
cancer : interleukin-1α protein secretion is correlated with
malignant phenotype. Clin Cancer Res 2003 ; 9 : 4877.
38 Kumar S, Kishimoto H, Chua HL, Badve S,
Miller KD, Bigsby RM, Nakshatri H. Interleukin-1
alpha promotes tumor growth and cachexia in MCF-7 xenograft model
of breast cancer. Am J Pathol 2003 ; 163 : 2531.
39 Naume B, Espevik T. Immunoregulatory effects of
cytokines on natural killer cells. Scand J Immunol 1994 ;
40 : 128.
40 Belluco C, Olivieri F, Bonafe M,
Giovagnetti S, Mammano E, Scalerta R,
Ambrosi A, Franceschi C, Nitti D, Lise M. 174
G>C polymorphism of interleukin 6 gene promoter affects
interleukin 6 serum level in patients with colorectal cancer. Clin
Cancer Res 2003 ; 9 : 2173.
41 Zhang GJ, Adachi I. Serum interleukin-6 levels
correlate to tumor progression and prognosis in metastatic breast
carcinoma. Anticancer Res 1999 ; 19 : 1427.
42 Shariat SF, Andrews B, Kattan MW, Kim J,
Wheeler TM, Slawin KM. Plasma levels of interleukin-6 and
its soluble receptor are associated with prostate cancer
progression and metastasis. Urology 2001 ; 58 : 1008.
43 Oka M, Yamamoto K, Takahashi M,
Hakozaki M, Abe T, Izuka N, Hazama S,
Hirazawa K, Hayashi H, Tangoku A, Hirose K,
Ishihara T, Suzuki T. Relationship between serum levels
of interleukin-6, various disease parameters, and malnutrition in
patients with esophageal squamous cell carcinoma. Cancer Res
2001 ; 19 : 1457.
44 Mouawad R, Benhammouda A, Rixe O,
Antoine EC, Borel C, Weil M, Khayat D,
Soubrane C. Endogenous interleukin-6 levels in patients with
metastatic malignant melanoma : correlation with tumor burden.
Clin Cancer Res 1996 ; 2 : 1405.
45 Berek JS, Chung C, Kaldi K, et al. Serum
interleukin-6 levels correlate with disease status in patients with
epithelial ovarian cancer. Am J Obestet Gynecol 1991 ;
164 : 1038.
46 Wu CW, Wang SR, Caho MF, Watson JM,
Knox RM, Martinez-Maza O. Serum interleukin-6 levels
reflect disease status of gastric cancer. Am J Gastroenterol
1996 ; 91 : 1417.
47 Hakan B, Gulcan U, Mustafa S, Mustafa Y,
Tomris O, Mehmet A, Hasan A, Ilhan A,
Burhan S. Tumour necrosis factor- alpha, interleukin-6, and
fasting serum insulin correlate with clinical outcome in metastatic
breast cancer patients treated with chemotherapy. Cytokine
2004 ; 27 : 58.
48 Yokoe T, Iino Y, Morishita Y. Trends of IL-6
and IL-8 levels in patients with recurrent breast cancer :
preliminary report. Breast Cancer 2000 ; 7 : 187.
49 Nishimura R, Nagao K, Miyayama H,
Mastsuda M, Baba K, Mastsuoka Y, Yamashita H,
Fukuda M, Mizumoto T, Hamamoto R. An analysis of
serum interleukin-6 levels to predict benefits of
medroxyprogesterone acetate in advanced or recurrent breast cancer.
Oncology 2000 ; 59 : 166.
|
Printable version
Version PDF
