ARTICLE
Auteur(s) :, Mahmoud Abu Elhija1, Hadas
Potashnik1, Eitan Lunenfeld2, Gad
Potashnik2, Stefan Schlatt3, Eberhard
Nieschlag4, Mahmoud
Huleihel1,*
1Department of Microbiology and Immunology, Faculty
of Health Sciences, Ben-Gurion-University of the Negev, Beer-Sheva,
Israel
2Department of Obstetrics and Gynecology, Soroka
University Medical Center, Faculty of Health Sciences,
Ben-Gurion-University of the Negev, Beer-Sheva, Israel
3University of Pittsburgh, Pittsburgh, Philadelphia,
USA
4Institute of Reproductive Medicine, Muenster
University, Muenster, Germany
Spermatogenesis is a highly controlled process of proliferation,
meiosis, and differentiation, which occurs in a number of sets of
spermatogenic cell associations or stages [1, 2]. In addition to
the regulatory effect of gonadotropins and androgens in the
initiation and maintenance of spermatogenesis, a number of
cytokines are also involved in the regulation of various
differentiation steps in this process [3-5].Clinical reports
indicate that systemic infection and chronic inflammation can
impair testicular steroidogenesis and spermatogenesis, leading to
temporary or permanent fertility problems [6-10]. Injection of an
animal subject with lipopolysaccharide (LPS), an endotoxin present
in the outer cell wall of the gram-negative bacteria, resulted in
inhibition of gonadotropin secretion by the pituitary, and
testosterone secretion by Leydig cells [10, 11]. In addition, LPS
induced an acute inflammatory response, mediated by an increased
proinflammatory cytokine secretion – mainly tumor necrosis alpha
(TNF-α), interleukin-(IL)-1 and IL-6 – by the immune system [12].
These cytokines could inhibit testicular steroidogenesis directly,
or indirectly by inducing glucocorticosteroid production following
activation of the hypothalamic-pituitary-adrenal axis [4, 13,
14].In the testicular compartments, LPS may induce various cell
types of immune and non-immune origin to produce cytokines. In the
testicular interstitial compartment, Leydig cells and macrophages
are the main responsive cells. In the seminiferous tubules, Sertoli
cells, germ cells and differentiated germ cells, and peritubular
cells produce cytokines [1, 4, 14]. It was demonstrated that
Sertoli cells secrete IL-6, which was increased following
stimulation with LPS, latex beads, residual bodies, low levels of
testosterone and FSH [15-17]. The levels of IL-6 varied throughout
different stages of the seminiferous epithelium cycle; high levels
were observed in stages II-VI and the lowest in stages VII-VIII
[15]. Leydig cells also express IL-6 following stimulation with LH,
LPS and IL-1 in vitro [18, 19]. Testicular macrophages were shown
to secrete IL-6 and other cytokines following stimulation with LPS
under in vitro conditions [20].IL-6 has been suggested to be a
potent inhibitor of meiotic DNA synthesis within the seminiferous
epithelium [21], and a stimulator of transferrin production by
Sertoli cells [18]. It was also shown to inhibit testosterone
secretion by Leydig cells [22].In the present study, we examined
the effect of systemic infection (i.p. injection of LPS) on the
expression levels of IL-6 in the testis of sexually immature and
adult mice.
Materials and methods
Materials
Interleukin-6 levels in testicular homogenates were examined using
a murine IL-6 Eli-pair kit (Diaclone, Besançon, France). This kit
recognizes both natural and recombinant murine IL-6, and has no
cross-reactivity with other murine cytokines. The range of the
standard curve was 2 to 500 pg/mL, and the sensitivity of the
kit was < 32 pg/mL.
LPS injection
The investigations were conducted in accordance with the Guiding
Principles for the Care and Use of Research Animals promulgated by
the Society for the Study of Reproduction. Sexually mature (adults)
(8-10 weeks old) and sexually immature (2 weeks old)
Balb/c mice were used. At the age of 2 weeks, even though
Sertoli cells are almost completely differentiated, the
spermatogenic process has not yet been completed and mice are not
producing spermatozoa [23]. Three mice were examined in each
experiment and each experiment was repeated more than 6 times.
Mice were injected (i.p.) with 2, 20 or
100 μg/mL/100 μL of LPS or saline (control). Three hours
or 24 hours later, mice were sacrificed by CO2
asphyxiation, and testicular tissues were immediately separated and
stored at -70 °C for RNA extraction or for
homogenate preparation.
Preparation of testicular homogenates
Testicular homogenates were prepared from immature and mature mice.
A single testis from each mature and two testes from each immature
mouse were prepared and examined separately. The tunica albugina
was removed from the testis and remaining testicular tissue was
homogenized in 0.8 mL cold PBS over ice. At the end of the
homogenization process, the mixture was centrifuged at
13 000 RPM for 15 min. and the supernatant was collected
and stored at -70 °C. Total protein was investigated using
Biorad reagent. IL-6 levels were measured using a specific ELISA
kit.
Extraction of total RNA and RT-PCR analysis
Total RNA was extracted from mouse testis using the EZ RNA Reagent
protocol (Biological Industries, Beit Haemek, Israel). First-strand
complementary DNAs (cDNAs) were synthesized from 2.5 μg total
RNA with 0.5 μg random oligonucleotide primers (Roche
Molecular Biochemicals, Mannheim, Germany) and 200 U of
Moloney-Murine Leukemia Virus-Reverse Transcriptase (M-MLV-RT; Life
Technologies, Inc., Paisley, Scotland, UK) in a total volume of
20 μL Tris-HCl-MgCl reaction buffer, supplemented with DTT,
dNTPs (0.5 mmol/L; Roche Molecular Biochemicals) and RNase
inhibitor (40 U; Roche Molecular Biochemicals). The reverse
transcriptase (RT) reaction was performed for 1 h at
37 °C and stopped for 10 min at 75 °C. The volume of
20 μL was subsequently made up to 60 μL with water.
Negative controls for the reverse transcriptase reaction (RT-) were
prepared in parallel, using the same reaction preparations with the
same samples, without M-MLV-RT.
The PCR, performed subsequently, contained cDNA samples in final
dilution of 1:15 with two pairs of oligonucleotide primers
(0.9 pmol/μL; 5′AGAGGGAAATCGTGCGTGAC3′; and
3′GCCGGACTCATCGTACTCCT5′ for the mouse β-Actin cDNA sequence, and
5′GACGATACCACTCCCAACAGACC3;’ and 3′ATGCTTAGGCATAACGCACTAGGTT5′ for
the mouse IL-6 cDNA sequence (Sigma). To assess the absence of
genomic DNA contamination in RNA preparations and RT-PCR reactions,
PCR was performed with negative controls for the RT reaction (RT-)
and without cDNA (cDNA-). The PCR reactions were carried out on a
Cycler II System Thermal Cycler (Ericomp, San Diego, CA, USA).
Twenty microliters of each PCR product were run on 2% agarose gel,
containing ethidium bromide, and photographed under UV light.
The RNA expression was quantified from the different samples of
the RT-PCR using TINA software (version 2.10g) (raytest
Isotopenmessgeraets, GmbH, Straubenhardt, Germany).
Evaluation of results
Each experiment included three to five mice within each adult and
immature group. Each experiment was repeated from three to six
times.
The levels of IL-6 were evaluated as pg/μg protein of the
testicular homogenate. The results are presented as the mean of
pg/μg protein ± SEM.
Statistics
Student’s t test was used for statistical evaluation, and p values
below 0.05 were considered significant.
Results
Over-expression of IL-6 in testicular homogenates of immature,
as compared to mature mice
IL-6 levels in testicular homogenates of immature mice were
significantly higher than in mature mice (both protein and RNA
levels), before and after LPS injection (figures 1,2) ; the scales
of the figures are different (see also our previous paper in the
present volume).
LPS induced the expression of IL-6 in testicular tissues of
mature mice
Intraperitoneal injection of LPS into mature mice significantly
increased IL-6 levels in their testicular homogenates, in a time-
and dose-dependent manner ( (figure 1A) ). After 3
hours of induction with 20 and 100 μg/mL LPS, the levels of
IL-6 in testicular homogenates of adult mice were significantly
increased (0.053 ± 0.015 pg/μg protein, p = 0.0012 and 0.046 ±
0.016 pg/μg protein, p = 0.032 respectively). However,
stimulation with 2 μg/mL of LPS for 3 hours did not
significantly increase IL-6 levels in testicular homogenates of
adult mice (0.038 ± 0.015 pg/μg protein, p = 0.39) as compared
to the control group (0.033 ± 0.01 pg/μg protein). Conversely,
stimulation of adult mice with various doses of LPS (i.p.) (2, 20
and 100 μg/mL) for 24 hours did not induce significantly
higher levels of IL-6 in testicular homogenates (0.041 ±
0.2 pg/μg protein; 0.04 + 0.014 pg/μg. protein and 0.043
± 0.018 pg/μg protein respectively), as compared to the
control group.
IL-6 mRNA expression was significantly increased after 3 and 24
hours of induction with various concentrations of LPS (2, 20 and
100 μg/mL; p < 0.005, p < 0.002 and p < 0.0005
respectively and p < 0.01, p < 0.03 and p < 0.03
respectively) as evaluated by RT-PCR ( (figure 1B) ) and
quantified by densitometry ( (figure 1C) ).
LPS induced higher expression of IL-6 in testicular tissues of
immature mice
Intraperitoneal injection of LPS into immature mice induced
significantly higher IL-6 levels in their testicular homogenates,
in a time- and dose-dependent manner ( (figure 2A) ). Stimulation
with 2, 20 and 100 μg/mL of LPS for 3 hours significantly
increased IL-6 levels in testicular homogenates of immature mice
(0.2 ± 0.09 pg/μg protein, p = 0.039; 0.32 ± 0.17 pg/μg
protein, p = 0.008 and 0.4 ± 0.17 pg/μg protein, p =
0.001 respectively) as compared to the control group (0.119 ±
0.04 pg/μg protein). Also, the levels of IL-6 in testicular
homogenates of immature mice were significantly increased after 24
hours of induction with 2 and 20 μg/mL LPS (0.26 ±
0.19 pg/μg protein, p = 0.036 and 0.31 ± 0.12 pg/μg
protein, p = 0.001 respectively), but not with 100 μg/mL LPS
(0.21 ± 0.15 pg/μg protein, p = 0.07).
IL-6 mRNA expression was significantly increased after 3 and 24
hours of induction with various concentrations of LPS (20 and
100 μg/mL; p < 0.0003 and p < 0.005 respectively and p
< 0.002, and p < 0.003 respectively), as evaluated by RT-PCR
( (figure 2B) ),
and quantified by densitometry ( (figure 2C) ).
Discussion
The cellular origins of IL-6 in the testis, under normal
conditions, involve all testicular compartments (see our paper
published in the present volume). Systemic inflammation, by i.p.
injection of LPS, could induce testicular cells to produce IL-6. It
was demonstrated that LPS induced testicular cells to secrete TNF,
IL-1 and IL-6 in vitro [4, 14, 24, 25]. Also, IL-1 and TNF-α
induced testicular macrophages, Sertoli cells and Leydig cells to
secrete IL-6 in vitro [4, 14, 25].
Systemic infection and inflammatory disease were found to
disrupt germ cell production and to impair the reproductive
capacity by decreasing steroidogenesis and testosterone levels
[6-10, 14]. It was shown that TNF, IL-1 and IL-6 decreased
testosterone secretion by Leydig cells [4, 14, 26, 27]. These
factors also affected transferrin secretion by Sertoli cells [4,
14, 26]. In addition, IL-1α was demonstrated to induce germ cell
proliferation; however, IL-6 inhibited this function [2, 28, 29].
IL-6 may also have potentially adverse effects on male reproductive
function, influencing the hypothalamic-pituitary-testicular
axis.
Recently, it was shown that LPS is a potent stimulator of
Sertoli cell proliferation in vitro, and that it can modulate the
mitogenic action of FSH on immature Sertoli cells, thus, disturbing
adult germ cell production [30].
IL-6 increases during infection/inflammation could inhibit the
immune response by inducing immunosuppressive factors such as
IL-1ra and sTNF and depressing regulation of TNF-α production [31],
thus protecting testicular tissue.
Thus, under pathological conditions IL-6 could interfere with
male fertility but may also play an important role in protecting
testicular tissue.
Acknowledgements
This work was partially supported by a grant (No. 1-760-205.2/2002)
from the German-Israel Foundation (GIF) and a grant (No. 4467) from
the Ministry of Health, Jerusalem.
References
1 Skinner MK. Cell-cell-interactions in the testis. Endocr Rev
1991; 12: 45.
2 De Kretser DM, Loveland KL, Meinhardt A,
Simorangkir D, Wreford N. Spermatogenesis. Hum Reprod
1999; 13: 1.
3 Weinbauer GF, Nieschlag E. Hormonal control of
spermatogenesis. In: de Kretser DM, ed. Molecular biology of
the male reproductive system. San Diego: Academic press, 1993:
99.
4 Huleihel M, Lunenfeld E. Regulation of
spermatogenesis by paracrine/autocrine testicular factors. Asian J
Androl 2004; 6: 259.
5 Schlatt S, Meinhardt A, Nieschlag E. Paracrine
regulation of cellular interactions in the testis: factors in
search of a function environment. Eur J Endocrinol 1997; 137:
107.
6 Adamopoulos DA, Lawrence DM, Vassilopoulos P,
Contoyiannis PA, Swyer GIM. Pituitary-testicular
interrelationships in mumps orchitis and other viral infections.
BMJ 1987; 1: 1177.
7 Buch JP, Havlovec SK. Variation in sperm penetration
assay related to viral illness. Fertil Steril 1991; 55: 844.
8 Cutolo M, Balleari E, Giush M,
Monachesi M, Accardo S. Sex hormone status of male
patients with rheumatoid arthritis: evidence of low serum
concentrations of testosterone at baseline and after human
chorionic gonadotropin stimulation. Arthr Rheumat 1988; 31:
1314.
9 Baker HWG. Reproductive effects of non-testicular
illness. Endocrinol Metabol Clin North Am 1998; 27: 831.
10 O’Bryan MK, Schlatt S, Phillips DJ, de
Krester DM, Hedger MP. Bacterial
lipopolysaccharide-induced inflammation compromises testicular
function at multiple levels in vivo. Endocrinology 2000; 141:
238.
11 Refojo D, Arias P, Moguilevsky JA,
Feleder C. Effect of bacterial Endotoxin on in vivo pulsatile
gonadotrophin secretion in adult male rats. Neuroendocrinology
1998; 67: 275.
12 Dinarello CA. Biologic basis for interleukin-1 in
disease. Blood 1996; 87: 2095.
13 Imura H, Fukata J, Mori T. Cytokines and
endocrine function: an interaction between the immune and
neuroendocrine system. Clin Endocrinol (Oxf) 1991; 35: 107.
14 Diemer T, Hales DB, Weinder W.
Immune-endocrine interactions and Leydig cell function: the role of
cytokines. Andrology 2003; 35: 55.
15 Syed V, Gerard N, Kaipia A, Bardin CW,
Parvinen M, Jegou B. Identification, ontogeny and
regulation of an interleukin-6 (IL-6) factor in the rat testis.
Endocrinology 1993; 132: 293.
16 Syed V, Stephan JP, Gerard N, Legrand A,
Parvinen M, Bardin CW, et al. Residual bodies
activate Sertoli cell interleukin-1a (IL-1a) release, which
triggers IL-6 production by an autocrine mechanism, through the
lipoxygenase pathway. Endocrinology 1995; 136: 3070.
17 Stephan JP, Syed V, Jegou B. Regulation of
Sertoli cell IL-1 and IL-6 production in vitro. Mol Cell Endocrinol
1997; 134: 109.
18 Boockfor FR, Schwarz LK. Effects of interleukin-6,
interleukin-2 and tumor necrosis factor alpha on transferrin
release from Sertoli cells in culture. Endocrinology 1991; 129:
256.
19 Cudicini C, Lejeune H, Gomez E,
Bosmans E, Ballet F, Saez J, et al. Human
Leydig Cells and Sertoli Cells are Producers of Interleukin-1 and
-6. J Clin Endocr Met 1997; 82: 1426.
20 Kern S, Robertson SA, Mau VJ, Maddocks S.
Cytokine secretion by macrophages in the rat testis. Biol Reprod
1995; 53: 1407.
21 Hakovirta H, Syed V, Jegou B, Parvinen M.
Function of interleukin-6 as an inhibitor of meiotic DNA synthesis
in the rat seminiferous epithelium. Mol Cell Endocrinol 1995; 108:
193.
22 Hales DB, Diemer T, Held-Hales K. Role of
cytokines in testicular function. Endocrinology 1999; 10: 201.
23 Lunenfeld B, Weissenberg R. In: Prunty FTG,
Gardiner-Hill H, eds. Modern trends in endocrinology-4.
Trowbridge & London: Redwood press Ltd, 1972: 157.
24 Huleihel M, Lunenfeld E, Horowitz S,
Levy A, Poashnik G, Glezerman M. Involvement of
serum and LPS in the production of interleukin-1- and
interleukin-6-like molecules by human sperm cells. Am J Reprod
Immunol 2000; 43: 41.
25 Hedger MP, Meinhardt A. Cytokines and the immune
testicular axis. J Reprod Immunol 2003; 58: 1.
26 Huleihel M, Zeyse D, Lunenfeld E,
Zeyse M, Mazor M. Induction of transferrin secretion in
murine Sertoli cells by FSH and IL-1; the possibility of different
mechanism(s) of regulation. Am J Reprod Immunol 2002; 47: 112.
27 Bornstein SR, Rutkowski H, Vrezas I. Cytokines
and steroidogenesis. Mol Cell Endocrinol 2004; 215: 135.
28 Parvinen M, Soder O, Mali P, Froysa B,
Ritzen EM. In vitro stimulation of stage-specific
deoxyribonucleic acid synthesis in rat seminiferous tubule segments
by interleukin-1a. Endocrinology 1991; 129: 1614.
29 Pollanen P, Soder O, Parvinen M.
Interleukin-1a stimulation of spermatogonial proliferation in vivo.
Reprod Fertil Dev 1989; 1: 85.
30 Peterson C, Froysa B, Soder O. Endotoxin and
proinflammatory cytokines modulate Sertoli cell proliferation in
vitro. J Reprod Immunol 2004; 61: 13.
31 Tilg H, Dinarello CA, Mier JW. IL-6 and APPs:
anti-inflammatory and immunosuppressive mediators. Immunol Today
1997; 18: 428.
|
Printable version
Version PDF
