ARTICLE
Human melanocytes are secretory neural crest-derived cells located within
the basal layer of the epidermis and in the matrix of hair follicles.
The main function of melanocytes is the synthesis of melanin pigment,
which is transferred to basal keratinocytes [1]. Melanization is
responsible for skin tanning, protection against ultraviolet damage and
photocarcinogenesis [2]. In the adult epidermis melanocyte mitosis
occurs rarely, but the cells can proliferate under physiological stimuli
such as ultraviolet radiation and wound healing [1-2]. Recent development
of cell culture systems allowing the generation of a large population
of normal melanocytes enhanced our knowledge of proliferation control
of melanocytes. In vitro requires synergistic mitogens in order
to proliferate. The best characterised growth factors for human melanocytes
are fibroblast growth factor 1 & 2, hepatocyte growth factor/scatter
factor, mast/stem cell factor, endothelins and melanotropin [3-6].
The proper function of these factors is likely to be important in vivo,
as all ligands are produced in the skin, and elimination or overexpression
of these ligands alters the normal distribution of melanocytes [3].
In contrast to these growth stimulating factors, interleukin-1 and
6 as well as tumor necrosis factor alpha show inhibitory properties [7].
Interleukin-8 or Groalpha are well characterised peptides of the
CXC-chemokine family consisting of 72 amino acids [8, 9]. The
amino acid sequences of these molecules are 42% identical [8-10].
CXC-chemokines are produced by a variety of tissues including monocytes,
fibroblasts, keratinocytes and melanocytic cells [8-12]. They have
chemotactic activity for neutrophils and serve as strong growth factors
in melanoma cells, with only limited proliferative activity towards normal
melanocytes[11-13]. Two different G-protein-coupled receptors for CXC-chemokines
in mammalian cells have been identified, termed CXC-chemokine receptor
I & II (CXCR1 & 2) [14, 15]. Their amino acid
sequences are 73% identical with most of the differences clustered at
the NH2- and COOH-termini [16]. Interleukin-8 binds
to both receptors with high affinity, whereas Groalpha interacts with
high affinity to the CXCR2 and with low affinity to the CXCR1 [16, 17].
Cell activation requires high affinity ligand binding interaction, whereas
low affinity binding of Groalpha with the CXCR1 did not initiate signal
transduction at physiologically relevant concentrations [16-18].
Recently, evidence has been provided that cell surface expression of CXCR1
& 2 is controlled by transcriptionally regulated protein
synthesis [19-21]. Here we analysed in melanocytes the influence
of various cytokines on the expression of CXCR1 & 2 and
the CXC-chemokine-induced proliferation.
Materials and methods
Recombinant human Groalpha, interleukin-8 (IL-8), tumor necrosis factor
alpha (TNFalpha), interleukin-1beta (IL-1beta),
interleukin-6 (IL-6) and interferon-gamma (INFgamma) were from PeproTech
(London, UK); interleukin-4 (IL-4), interleukin-13 (IL-13), granulocyte-colony
stimulating factor (GCSF), basic fibroblast growth factor, endothelin-1,
alpha-melanocyte stimulating hormone, melanocyte growth medium supplemented
with bovine pituitary extract, 1 mug/l basic fibroblast growth factor
(bFGF), 10 mug/l phorbol 12-myristate 13-acetate (PMA), 5 mg/l
insulin, 500 mug/l hydrocortisone, 0.8% (v/v) gentamycin and 0.8%
(v/v) amphotericin B, was from Promocell (Heidelberg, Germany); actinomycin
D, phorbol 12-myristate 13-acetate (PMA) and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium
bromide (MTT) was from Sigma (Deisenhofen, Germany); GeneAmp RNA PCR kit
was from Perkin Elmer (Norwalk, CT); TA cloning kit was from Invitrogen
(Leek, Netherlands); fluorescein-labeled goat f(ab')2-fragments
anti-rabbit f(ab')2-fragments were from Dianova (Hamburg, Germany);
fluorescein-conjugated anti-bromodeoxyuridine F(ab)2-fragments
from Boehringer (Mannheim, Germany), polyclonal rabbit anti-human CXC-chemokine
receptor type I IgG (N-19) from Santa Cruz (Santa Cruz, CA); polyclonal
rabbit anti-human CXC chemokine receptor type II IgG was described [22].
Cell culture of normal human melanocytes
Human melanocytes were isolated from freshly prepared foreskin and maintained
melanocyte growth medium (MGM) supplemented with bovine pituitary extract,
1 mug/l basic fibroblast growth factor (bFGF), 10 mug/l phorbol
12-myristate 13-acetate (PMA), 5 mg/l insulin, 500 mug/l hydrocortisone,
0.8% (v/v) gentamycin and 0.8% (v/v) amphotericin B as described [22].
Reverse transcription and polymerase chain reaction
The mRNA expression of CXCR I and II was analysed semiquantitatively by
reverse transcription followed by polymerase chain reaction as described [23].
Total mRNA was isolated by guanidinium-phenol-chloroform extraction and
cDNA was obtained with the GeneAmp RNA PCR kit (Perkin Elmer, Norwalk,
CT). Specific cDNA were amplified by polymerase chain reaction (PCR) using
CCTGTATGCTAGAAAC3' and 5'TTCGTCTGTCAATGTCTC3' as primers for CXCRI, 5'CCTTTTCTACTAGATGCCGC
3' and 3'GAAACAACCGAGAAGAAG5' for the CXCRII, 5'CCACCCATGGCAGCAAATTCCATGGCA3'
and 3'AGTGGACCTGACCTGCCGTGTAGA5' for the house keeping gene GAPDH. Amplification
was performed in an automatic temperature cycler with 30 cycles at
95 °C, 60 °C and 72 °C (1 min each). In order to assure
linear cDNA amplification different amplifying cycles (22-36) were checked.
Linear amplification quantifying the optical density of the generated
bands were obtained between 22 and 32 cycles. The specificity
of the generated products were proven by sequencing after cloning using
pCR®II vector (Invitrogen, Leek, Netherlands).
Analysis of protein expression of CXCRI and II
by flow cytometry
Cells were incubated with f(ab')2-fragments against the indicates
receptors for 30 min on ice. Bound f(ab')2-fragments were
stained with fluorescein-conjugated goat f(ab')2-fragment anti-rabbit
f(ab')2-fragments (Dianova, Hamburg, Germany). Fluorescence
profiles were analysed by flow cytometry [22].
Proliferation assays
Normal human melanocytes were plated in flat-bottomed 96-well plates containing
MGM culture medium supplemented with bovine pituitary extract, 1 mug/l
basic fibroblast growth factor (bFGF), 10 mug/l phorbol 12-myristate
13-acetate (PMA), 5 mg/l insulin, 500 mug/l hydrocortisone,
0.8% (v/v) gentamycin and 0.8% (v/v) amphotericin B for 10 h.
Thereafter medium was removed, and the cells were maintained in MGM medium
without supplementation for 16 h. Indicated concentrations of stimuli
were added to the cell culture and proliferation was evaluated by MTT-test [22]
or by 5-bromo-2'-deoxyuridine incorporation [24].
Results
Two G-protein coupled receptors for the CXC-chemokines IL-8 and Groalpha
have been identified. To analyse the expression of these receptors at the
cell surface of normal melanocytes flow cytometric studies with specific
antibodies were performed. The higher fluorescence profile in cells incubated
with f(ab')2-fragments against the CXCRII in comparison to control
f(ab')2-fragments indicates expression of this receptor in melanocytes
(Fig. 1A). In contrast,
no indication for protein expression of CXCRI in melanocytes could be found
(data not shown). The transcriptionally regulated expression of CXCRI & II
can be controlled by various cytokines in leukocytes [19-21]. Next,
the influence of cytokines, growth factors and pharmacological agents such
as tumor necrosis factor alpha (TNFalpha), interleukin-1beta (IL-1beta),
interleukin-4 (IL-4), interleukin-6 (IL-6), interleukin-13 (Il-13), interferon-gamma
(INFgamma), granulocyte-colony stimulating factor (GCSF), forskolin, phorbol
ester and a growth factor cocktail consisting of basic fibroblast growth
factor, endothelin-1 and alpha-melanocyte stimulating hormone on CXCRII
protein expression at the cell membrane was analysed. Significant enhanced
expression of CXCRII after incubation with TNFalpha was already observed
after 24 h and more pronounced after 48 h (Fig. 1B).
The effect of TNFalpha was concentration dependent with half-maximal and
maximal effects at 2 ng and 20 ng/ml, respectively. In addition,
no protein expression of CXCRI after treatment with the described cytokines
were found in melanocytes (data not shown). All other tested agents had
no significant effect (Table
I).
Expression of CXCRII in melanocytes after stimulation with various stimuli.
Melanocytes were incubated with and without 20 ng/ml TNFalpha, 10 - 6
M phorbol ester, 100 U/ml IL-1beta, 20 ng/ml IL-4, 100 U/ml
IL-6, 20 ng/ml IL-13, 100 U/ml INFgamma, 50 ng/ml GCSF,
10 - 5 M forskolin and a growth factor cocktail of
0.6 ng/ml basic fibroblast growth factor, 10 nM endothelin-1 and
10 nM alpha-melanocyte-stimulating hormone for 24 h or 48 h.
Thereafter the expression of CXCRII at the cell surface was analysed by
flow cytometry and specific bound fluorescence deltaFL (difference of
the mean fluorescence channel in the presence of control or CXCRII antibodies)
was calculated. Data are means ± SD (n = 3).
To determine whether TNFalpha-induced CXCRII expression was due to transcriptionally
regulated de novo protein synthesis, experiments with the transcription
inhibitor actinomycin D were performed. Control cells in its absence and
presence showed a mean fluorescence of 185 ± 27 and 154 ± 19 channels.
TNFalpha enhanced the CXCRII expression to 645 ± 42 channels,
whereas optimal concentrations of actinomycin D inhibited completely the
TNFalpha effect reducing the fluorescence to 192 ± 24 channels.
To analyse the mRNA expression of CXCRII in melanocytes semi-quantitative
RT-PCR experiments were performed. As shown in Fig. 2A,
the expected CXCRII-product with 969 bases and the GAPDH product were
detected. In contrast, no product was obtained with primers for CXCRI. The
cytokine TNFalpha enhanced in a concentration-dependent manner the CXCRII
expression (Fig. 2B).
Again, no product was obtained with primers for CXCRI in samples of TNFalpha-treated
melanocytes (data not shown). In addition, no generated PCR-products were
obtained omitting MMLV reverse transcriptase in the reaction with all samples
(data not shown).
To analyse the function of altered CXCRII expression, proliferation tests
with bromodesoxyuridine (Fig. 3A
and B) and MTT (Fig. 3C
and D) were performed. As already reported the CXC-chemokines IL-8 and
Gro had a proliferative activity in normal melanocytes [13]. In accordance
with the literature, TNFalpha itself inhibited the proliferation response
in melanocytes [7]. However the addition of CXC-chemokines to TNFalpha-
preincubated melanocytes not only reversed the inhibitory effect of TNFalpha,
but provoked a strong proliferative activity in melanocytes in a dose
dependent manner. Next, we address the kinetic of TNFalpha effect on CXC-chemokine-induced
proliferation (Table II).
The effect of TNFalpha was time dependent with half-maximal and maximal
effects after 24-26 h and 48-60 h, respectively.
Discussion
CXC-chemokines have been implicated in causing and/or amplifying inflammatory
processes [8]. In addition they act as an autocrine growth factor
in malignant melanoma, promote melanocyte transformation, but have only
limited proliferative activity towards normal melanocytes [9, 13,
22]. Previously it has been shown that reactivity of cells towards CXC-chemokines
can be controlled by cytokine-induced expression of CXC-chemokine receptor [19-21].
These reports prompted us to analyse which commonly expressed cytokines
in the skin influence the expression of CXCR and the proliferative activity
of CXC-chemokines in normal human melanocytes.
In this study we demonstrated that normal melanocytes constitutively express
CXCRII mRNA and protein, whe reas we found no indication for the expression
of CXCRI. Flow cytometric studies performed here revealed that expression
of CXCRII could be up-regulated in a time and concentration-dependent
manner by TNFalpha, whereas IL-1, IL-4, IL-6, IL-13, INFgamma, GCSF, phorbol
ester, forskolin, and a growth factor cocktail consisting of basic fibroblast
growth factor, endothelin-1 as well as alpha-melanocyte stimulating
hormone provoked no significant alterations. Regulation of CXCRII expression
has been previously reported in granulocytes by granulocyte colony-stimulating
factor and in monocytes by interleukin-4 and-interleukin-13 [19-21].
In addition, we have shown here inhibition of the TNFalpha effect on CXCRII
expression by the transcription blocking agent actinomycin D and we have
reported here enhanced CXCRII mRNA levels after stimulation with TNFalpha.
This indicates that TNFalpha induced de novo synthesis of CXCRII
in melanocytes. The here observed effect could be caused either by prolonged
stability of the CXCRII mRNA transcripts or by enhanced gene transcription.
In order to evaluate the biological relevance of altered CXCRII expression
in melanocytes after TNFalpha treatment, two different proliferation assays
were performed. Hereby we could confirm that both chemokines had proliferative
activity for melanocytes [13]. In addition, we also saw that TNFalpha
alone inhibited constitutive proliferation of melanocytes, as previously
published [7]. The underlying mechanisms of this negative effect
of TNFalpha on proliferation are currently not understood and could be
the consequence of induction of apoptosis in subsets of melanocytes or
the consequence of a stop in G0 or G1 phase of the
cell cycle. However, addition of CXC-chemokines to TNFalpha-pretreated
melanocytes not only reversed the inhibitory effect of TNFalpha, but also
provoked a strong proliferation response. In vitro and probably
also in vivo melanocytes require synergistic growth factors for
proliferation [3]. The best studied combinations in this context
are cocktails of fibroblast growth factor, hepatocyte growth factor/scatter
factor, mast/stem cell factor, endothelins and melanotropin [3-6].
Data presented here implicate that a sequential application of TNFalpha
and CXC-chemokine has a good proliferative activity. Under these circumstances
TNFalpha induces expression of the CXCRII in order to sensitise melanocytes
for the biological activity towards CXC-chemokines. In this context it
might be of interest that TNFalpha and CXC-chemokine are UV-light-inducible
genes [25, 26]. Therefore, one could assume that both cytokines,
TNFalpha and CXC-chemokines might participate in UV-light-induced proliferation
of melanocytes in the skin. Moreover, UV-light is an epidemiological risk
factor for melanoma, even though its specific contribution to tumor induction
and progression is poorly understood [27]. The first critical step
of melanoma development might be disruption of the homeostatic balance
of growth and induction of imbalanced proliferation. Based on these in
vitro data it might certainly be possible to speculate that interactive
mechanism between TNFalpha and CXC-chemokine could contribute to the initiation
of malignant melanoma.
Article accepted on 13/01/2003CONCLUSION In
summary this study revealed that TNFalpha induces expression of CXCRII and
magnifies the proliferative activity of CXC-chemokines in melanocytes. The
reported interaction between these cytokines might influence the homeostatic
growth of melanocytes in the skin.REFERENCES
De Luca M, Bondanza S, Di Marco E, Marchisio P C, D'Anna F, Franzi AT,
Cancedda R. Keratinocyte-melanocyte interactions in vitro reconstituted
normal human epidermis In: Leigh IM, Lane B, Watt FM, eds. The Keratinocyte
Handbook Cambridge: Cambridge University Press, 1994: 95-104.
Prota G. Melanins, melanogenesis and melanocytes: looking at their functional
significance from the chemist's viewpoint. Pigment cell res 2000;
13: 283-93.
Halaban R. The regulation of normal melanocyte proliferation. Pigment
cell res 2000; 13: 4-14.
Imokawa G, Kobayasi T, Miyagishi M. Intracellular signaling mechanisms
leading to synergistic effects of endothelin-1 and stem cell factor
on proliferation of cultured human melanocytes. Cross-talk via trans-activation
of the tyrosine kinase c-kit receptor. J Biol Chem 2000; 275: 33321-8.
Suzuki I, Cone RD, Im S et al. Binding of melanotropic hormones
to the melanocortin receptor MC1R on human melanocytes stimulates proliferation
and melanogenesis. Endocrinology 1996; 137: 1627-33.
Swope VB, Medrano EE, Smalara D, Abdel-Malek ZA. Long-term proliferation
of human melanocytes is supported by the physiologic mitogens alpha-melanotropin,
endothelin-1, and basic fibroblast growth factor. Exp Cell Res
1995; 217: 453-9.
Krasagakis K, Garbe C, Eberle J, Orfanos CE. Tumor necrosis factor and
several interleukins inhibit the growth and modulate the antigen expression
of normal human melanocytes in vitro. Arch Dermatol Res 1995; 287:
259-65.
Baggiolini M, Dewald B, Moser B. Interleukin-8 and related chemotactic
cytokines - CXC and CC chemokines. Adv Immunol 1993; 55: 97-179.
Richmond A, Balentien E, Thomas et al. Molecular characterization
and chromosal mapping of melanoma growth stimulatory activity, a growth
factor structurally related to §-thromboglobulin. EMBO J 1988;
7: 2025-33.
Lindley I, Aschauer H, Seifert JM et al. Synthesis and expression
in Eschericia coli of the gene encoding monocyte-derived neutrophil activating
factor: Biological equivalence between natural and recombinant neutrophil
activating factor. Proc Natl Acad Sci U.S.A. 1988; 85: 9199-203.
Richmond A, Thomas HG. Melanoma growth stimulating activity: Isolation
from human melanoma tumours and characterisation of tissue distribution.
J Cell Biochem 1988; 36: 185-98.
Schrder JM, Peerson NLM, Christophers E. Lipopolysaccharide-stimulated
human monocytes secrete, apart from neutrophil-activating peptide 1/interleukin-8,
a second neutrophil activating protein. NH2-terminal amino acid sequence
identity with melanoma growth stimulatory activity. J Exp Med 1990;
171: 1091-100.
Bordoni R, Fine R, Murray D, Richmond A. Characterization of the role
of melanoma growth stimulatory activity (MGSA) in the growth of normal
melanocytes, nevocytes, and malignant melanocytes. J Cell Biochem
1990; 44: 207-19.
Murphy PM, Tiffany HL. Cloning of complementary DNA encoding a functional
interleukin-8 receptor. Science 1991; 253: 1280-2.
Holmes WE, Lee J, Kuang WJ et al. Structure and expression of a
human interleukin-8 receptor. Science 1991; 253: 1278-80.
La Rosa GJ, Thomas KM, Kaufmann ME et al. Amino terminus of the
interleukin-8 receptor is a major determinant of receptor subtype
specifity. J Biol Chem 1992; 267: 25002-6.
Schraufstätter IU, Barritt DS, Ma M et al. Multiple sites on IL-8 responsible
for binding to a and § IL-8 receptors. J Immunol 1993; 151:
6418-28.
Loetscher P, Seitz M, Clark-Lewis I et al. Both interleukin-8 receptors
independently mediate chemotaxis. FEBS Lett 1994; 341: 187-92.
Sprenger H, Lloyd AR, Lautens LL et al. Structure, genomic organization,
and expression of the human interleukin-8 receptor B gene. J Biol
Chem 1994; 269: 11065-72.
Sprenger H, Lloyd AR, Meyer RG et al. Genomic structure, characterization,
and identification of the promoter of the human IL-8 receptor A gene.
J Immunol 1994; 153: 2524-32.
Bonecchi R, Facchetti F, Dusi S et al. Induction of functional
IL-8 receptors by IL-4 and IL-13 in human monocytes. J
Immunol 2000; 164: 3862-9.
Norgauer J, Metzner B, Schraufstätter I. Expression and growth-promoting
function of the IL-8 receptor in human melanoma cells. J Immunol
1996; 156: 1132-7.
Dichmann S, Rheinen H, Panther E et al. Downregulation of platelet-activating
factor responsiveness during maturation of human dendritic cells. J
Cell Physiol 2000; 185: 394-400.
Mazzini G, Danova M, Ferrari C et al. Cell proliferation and ploidity
of human solid tumors. Methodical experience with the vivo bromodeoxyuridine
and DNA flow cytometry. Anal Cell Pathol 1996; 10: 101-13.
Countryman NB, Pei Y, Yi Q et al. Evidence for involvement of the
epidermal platelet-activating factor receptor in ultraviolet-B-radiation-induced
interleukin-8 production. J Invest Dermatol 2000; 115: 267-72.
Strickland I, Rhodes LE, Flanagan BF, Friedmann PS. TNF-alpha and IL-8 are
upregulated in the epidermis of normal human skin after UVB exposure:
correlation with neutrophil accumulation and E-selectin expression. J
Invest Dermatol 1997; 108: 763-8.
Berking C, Takemoto R, Satyamoorthy K et al. Basic fibroblast growth
factor and ultraviolet B transform melanocytes in human skin. Am J
Pathol 2001; 158: 943-53.
|
Summary
Pictures