Texte intégral de l'article
 
   

Expression of CD40 and CD40 ligand in Bowen’s disease and squamous cell carcinoma


European Journal of Dermatology. Volume 10, Number 6, 439-42, September 2000, Revues


Summary  

Author(s) : Y. Amo, Y. Ohta, Y. Hamada, M. Tatsuta, K. Katsuoka, Department of Dermatology, Kitasato University School of Medicine, 1-15-1 Kitasato, Sagamihara, Kanagawa 228-8555, Japan..

Summary : CD40 is a member of the tumor necrosis factor receptor super-family expressed by B cells, monocytes, dendritic cells, epithelial cells and hematopoietic progenitor cells. CD40 has recently been reported to be expressed on several epidermal tumors as well. CD40 on epidermal tumor cells interacts with lymphocytes expressing ligand for CD40 (CD40L) or monoclonal antibodies against CD40 with a significant decrease in proliferation. In this study, we examined the expression of CD40 and CD40L in Bowen’s disease and squamous cell carcinoma (SCC). CD40 immunoreactivity was observed in a significantly lower proportion of tumor cells from SCC than from Bowen’s disease. CD40L mRNA expression was detected in Bowen’s disease and SCC by reverse transcriptase polymerase chain reaction (RT-PCR). CD40-CD40L interactions in epidermal tumors may play a role in the proliferation, and the lack of CD40 in tumor cells from SCC might be involved in the mechanisms of escape from the growth inhibitory effect.

Keywords : CD40, CD40 ligand, Bowen’s disease, squamous cell carcinoma.

Pictures

ARTICLE

The CD40 surface molecule is a 45-50 kDa type I membrane glycoprotein, which is a member of the nerve growth factor receptor/tumor necrosis factor receptor super-family. The functions of CD40 have been characterized primarily in B cells. Cells expressing ligand for CD40 (CD40L) or monoclonal antibodies against CD40 (anti-CD40 mAb) mediate a variety of effects on B cells, including regulation of their proliferation and differentiation [1-5]. Recently, CD40 has been shown to be expressed functionally on non-hematopoietic cells, such as human epidermal cells [6-10]. Furthermore, it has been reported that CD40-CD40L interactions inhibit the proliferation of several epidermal tumors [7, 11, 12]. Epidermal tumors are characterized by a predominantly T cell-mediated immune reaction. CD40-CD40L interactions on epidermal tumors may be a signal for regulation of their proliferation. In the present study, we investigated the in situ expression of CD40 and CD40L in Bowen's disease and SCC.

Materials and methods

Preparation of skin specimens

For immunohistochemistry and RT-PCR analysis, tumor tissue samples were obtained from surgical specimens of in situ SCC (Bowen's disease, n = 10) and SCC (n = 10). Normal human skin (n = 3) was used as a control. In all samples, both immunohistochemistry and RT-PCR analysis were performed on sequential cryostat sections. Immediately after excision, the specimens were frozen in liquid nitrogen, embedded in OCT compound and stored at ­ 80° C until further processing.

Immunohistochemistry

Five mum-thick-tissue sections were fixed with acetone for 5 minutes. These sections were stained with anti-CD40 mAb EA-5 (Serotec Ltd., Kidlington, England) or mAb89 (Cosmobio Co., Tokyo, Japan) and anti-CD40L mAb (Serotec Ltd.) and then developed by the standared Avdin-Biotin-Peroxidase-Complex (ABC) method using peroxidase-labelled anti-mouse antibody as a second antibody.

CD40L RT-PCR

We extracted total RNA from cryostat sections using ISOGEN (Nippon Gene Co., Toyama, Japan) according to the manufacturer's instructions. One microgram of the total RNA was reverse transcribed into cDNA in a 20 mul reaction mixture containing 1 x RT buffer (GIBCO BRL, Rockville, MD, USA), 0.5 mM of dNTPs (Takara Shuzo Co., Otsu, Japan), 0.5 mug of oligo-dT primer, 40 U of RNase inhibitor (Boehringer Mannheim Co., Mannheim, Germany), 200 U of M-MLV reverse transcriptase (GIBCO BRL), and 10 mM of DTT (GIBCO BRL). After incubation at 43° C for 1 hour and then at 95° C for 3 minutes, the cDNA was amplified using 1 mul of the cDNA preparation for CD40L or CD3delta in a 25 mul reaction mixture containing 10 mM of Tris-HCl, pH 9.0, 50 mM of KCl, 2.5 mM of MgCl2, 0.1% (W/V) gelatin, 0.2 mM of dNTPs, 25 pM of 5' and 3' oligonucleotide primers, and 2.5 U of Taq polymerase (Perkin-Elmer, Branchburg, NJ). A DNA thermocycler 480 (Perkin-Elmer Cetus, Norwalk, CT) was used for 35 cycles of denaturation at 94° C for 1 minute, annealing at 64° C for 2 minutes and extention at 72° C for 2 minutes (in the case of CD40L) or denaturation at 94° C for 0.5 minutes, annealing at 65° C for
1 minute and extention at 72° C for 0.5 minutes (in the
cases of CD3delta). The following primers were used for cDNA amplification: CD40L (5' primer: ACATACAACCAAACTTCTCCC; 3' primer: AGATGTTGTTTTACTGCTGGC) [13], CD3delta (5' primer: CTGGACCTGGGAAAACGCATC; 3' primer: GGTGGCT.
GTACTGAGCATCATC), and beta-actin (5' primer: GTGGGGCGCCCCAGGCACCA; 3' primer: CTCCTT
AATGTCACGCACGATTTC). The PCR product was subjected to electrophoresis in 1.5% agarose gel and visualized by staining with ethidium bromide.

Peripheral blood mononuclear cells (PBMC) were obtained from healthy donors by centrifugation of heparinized blood over a Ficoll-Hypaque gradient. PBMCs (6.0 x 106 /ml) were stimulated in complete RPMI medium with 10 ng/ml Phorbol 12-Myristate 13-Acetate (PMA) and 3 mug/ml phytohemagglutinin-P. After the 4 hour stimulation, RNA prepared from the cells was reverse transcribed, and PCR analysis with primers specific for the CD40L, CD3delta, and beta-actin was performed as well.

In situ hybridization of CD40L mRNA

For the generation of hybridization probes, we used a human CD40L cDNA PCR product containing a 399-bp fragment (49 to 447). The cDNA was subcloned using a TA cloning kit. Sense and antisense CD40L RNA probes were generated by SP6 or T7 RNA polymerases. The probes were labeled with digoxigenin-11-UTP using in vitro transcription. Serial cryostat sections of biopsy material were mounted on aminopropylsilane-coated slides, followed by fixation in freshly prepared 4% paraformaldehyde and permeation with 1 mug/ml proteinase K for 15 min at 37° C. The sections were acetylated for 10 min with 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0), and dehydrated in ethanol. Hybridization was performed in a sealed, humid box for 16 hours at 50° C in hybridization solution (Boehringer Mannheim Co.) and digoxigenin-labeled RNA probes at a concentration of 100 mug per ml. The slides were washed in 50% formamide/2 x sodium citrate/sodium chloride buffer, treated with RNase A (20 mug per ml), further washed in 2 x sodium citrate/sodium chloride buffer for 20 min at 50° C, two changes of 0.2 x sodium citrate/sodium chloride buffer for 20 min at 50° C, and then blocked with blocking solution (Boehringer Mannheim Co.) at room temperature for 1 hour. After blocking, the sections were washed and incubated with anti-digoxigenin and Fab fragments conjugated to alkaline phosphatase (Boehringer Mannheim Co.) at room temperature for 30 min. The sections were washed, and then incubated with nitroblue tetrazolium and 5-bromo-4-chloro-3 indolyl phosphate at 37° C for 20 h. The slides were then mounted and viewed by light microscopy. PBMCs stimulated with PMA and phytohemagglutinin-P were used as a control. After the 4 hour stimulation, in situ hybridization analysis was done using sense and antisense CD40L RNA probes.

Results

CD40 and CD40L immunoreactivity in Bowen's disease and SCC

In normal skin, CD40-expressing cells could be detected by anti-CD40 antibody EA-5 or mAb89 in the epidermis, especially in the basal and suprabasal layers. CD40 immunoreactivity was mainly detected in the cytoplasm of the basal cells. In the dermis, endothelial cells and dendritic cells also showed CD40 immunoreactivity (Fig. 1). CD40 was also expressed in the basal and suprabasal layers in all Bowen's disease tissues; the intensity of CD40 immunoreactivity decreased toward the upper epidermis and the expression pattern became heterogeneous (Fig. 2). CD40 immunoreactivity was not seen in 90% (9 of 10) of the SCC cases (Fig. 3). In one SCC case, a weak CD40 immunoreactivity was confined to the marginal portion of the cancer nest (Table I). CD40L immunoreactivity was not seen in any infiltrating lymphocytes of the normal human skin, Bowen's disease and SCC.

Detection of CD40L mRNA by RT-PCR

Expression of CD40L and CD3delta mRNA was demonstrated in Bowen's disease and SCC as well as in PBMC stimulated with PMA and phytohemagglutinin-P. A close correlation was present between the CD40L and CD3delta mRNA expressions. Normal human skin did not contain detectable CD40L mRNA (Fig. 4).

Detection of CD40L mRNA by in situ hybridization

In situ hybridization with sense and antisense CD40L probes gave no positive reaction in any infiltrating lymphocytes of the normal human skin, Bowen's disease and SCC. In situ hybridization with the CD40L antisense probe showed strong CD40L mRNA expression in PBMC stimulated with PMA and phytohemagglutinin-P (Fig. 5).

Discussion

The growth regulation of human epidermal cells has been investigated in detail, and several factors have been characterized [7, 11, 12]. CD40-CD40L interactions have been shown to inhibit the proliferation of several epidermal cell types, including carcinomas and normal human keratinocytes [7, 11, 12]. We previously elucidated the function of CD40 on epidermal tumors in vitro and found that trichilemmoma (KTL-1) cells established from a benign hair follicular tumor [14] constitutively express CD40 and respond to CD40 ligation by anti-CD40 mAb EA-5 with a significant decrease in proliferation [12]. We were also able to demonstrate that KTL-1 cells respond to CD40 ligation by EA-5 with up-regulation of interleukin-6 (IL-6) mRNA expression [12]. CD40-CD40L interactions in carcinoma cell lines have been reported to include activation of the NF-kappaB transcription factor, engagement of the c-Jun N-terminal kinase cascade, and up-regulation of intercellular adhesion molecule 1 (ICAM-1) and IL-6, which are believed to be important for the costimulation, expansion and effector function of T cells [15-17]. It has been suggested that the reduced CD40 expression may contribute to ineffective cell-cell contact-dependent interactions between the tumor cells and activated T cells expressing CD40L [15, 18]. As demonstrated in this study, CD40 was either lost or showed drastically reduced immunoreactivity in situ in tumor cells from SCC, whereas CD40-expressing cells were detectable in the basal epidermal cells in Bowen's disease. We previously demonstrated in vitro by flow cytometry that almost all of the KTL-1 cells were positive for the CD40 surface protein, whereas the SCC cell line contained a CD40-negative sub-population, indicating that percentage positivity for CD40 is lower in SCC cells [12]. Collectively, these findings suggest that the lack of in situ CD40 expression in tumor cells from SCC may represent some ability to escape from the growth-inhibitory effect of CD40-CD40L interactions, and the CD40 expression in the basal layers in Bowen's disease may provide a suitable milieu for the T cell-mediated immunosurveillance system.

In the present study, CD40L mRNA expression was detected in all lesions of Bowen's disease and SCC by RT-PCR analysis. However, we could not detect CD40L expression by immunohistochemistry and in situ hybridization in any infiltrating lymphocytes in Bowen's disease or SCC. CD40L is rapidly but transiently expressed on the surface of CD4+ memory T cells after activation through the T cell receptor complex [13, 19]. The CD40L expression may be difficult to detect by immunohistochemistry or in situ hybridization.

Taken together, these results suggest that the lack of CD40 expression in tumor cells from SCC, in comparison with Bowen's disease, might represent some ability to escape from the growth-inhibitory effect of CD40-CD40L interactions. Further study will be necessary to define the CD40-CD40L interactions in epidermal tumors.

Article accepted on 31/5/00

REFERENCES

1. Clark EA, Ledbetter JA. Activation of human B cells mediated through two distinct cell surface differentiation antigens. Proc Natl Acad Sci USA 1986; 83: 4494-8.

2. Ledbetter JA, Shu G, Gallagher M, Clark EA. Augmentation of normal and malignant B cell proliferation by monoclonal antibody to the B cell-specific antigen Bp50 (CDw40). J Immunol 1987; 138: 788-94.

3. Armitage RJ, Fanslow WC, Strockbine L, Sato TA, Clifford KN, Macduff BM, Anderson DM, Gimpel SD, Davis-Smith T, Maliszewski CR, Clark EA, Smith CA, Grabstein KH, Cosman D, Spriggs MK. Molecular and biological characterization of a murine ligand for CD40. Nature 1992; 357: 80-2.

4. Banchereau J, Bazan F, Blanchard D, Brière F, Galizzi JP, Kooten C, Liu FR, Rousset F, Saeland S. The CD40 antigen and its ligand. Annu Rev Immunol 1994; 12: 881-922.

5. Snapper CM, Zelazowski P, Rosas FR, Kehry MR, Tian M, Baltimore D, Sha WC. B cells from p50/NF-kappaB knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. J Immunol 1996; 156: 183-91.

6. Hess S, Rensing-Ehl A, Schwabe R, Bufler P, Engelmann H. CD40 function in nonhematopoietic cells. J Immunol 1995; 155: 4588-95.

7. Péguet-Navarro J, Dalbiez-Gauthier C, Moulon C, Berthier O, Réano A, Gaucherand M, Banchereau J, Rousset F, Schmitt D. CD40 ligation of human keratinocytes inhibits their proliferation and induces their differentiation. J Immunol 1997; 158: 144-52.

8. Clark EA, Shu G. Association between IL-6 and CD40 signaling. J Immunol 1990; 145: 1400-6.

9. Gillitzer R, Berger R, Mielke V, Müller C, Wolff K, Stingl G. Upper keratinocytes of psoriatic skin lesions express high levels of NAP-1/IL-8 mRNA in situ. J Invest Dermatol 1991; 97: 73-9.

10. Gaspari AA, Sempowski GD, Chess P, Gish J, Phipps RP. Human epidermal keratinocytes are induced to secrete interleukin-6 and co-stimulate T lymphocyte proliferation by a CD40-dependent mechanism. Eur J Immunol 1996; 26: 1371-7.

11. Elipoulos AG, Dawson CW, Mosialos G, Floettmann JE, Rowe M, Armitage RJ, Dawson J, Zapata JM, Kerr DJ, Wakelam MJO, Reed JC, Kieff E, Young LS. CD40-induced growth inhibition in epithelial cells is mimicked by Epstein-Barr virus-encoded LMP1: involvement of TRAF3 as a common mediator. Oncogene 1996; 13: 2243-54.

12. Amo Y, Ohta Y, Katsuoka K, Tamauchi H. CD40 ligation inhibits trichilemmoma cell proliferation and induces IL-6 production. J Dermato Sci 2000; 22: 125-31.

13. Desai-Mehta A, Lu L, Ramsalind-Goldman R, Datta SK. Hyperexpression of CD40 ligand by B and T cells in human lupus and its role in pathogenic autoantibody production. J Clin Invest 1996; 97: 2063-73.

14. Kanzaki T, Eto H, Umezawa A, Maeda T, Iwase H, Ito M. Morphological, biological and biochemical characteristics of a benign human trichilemmoma cell line in vivo and in vitro. Cancer Res 1981; 41: 2468-75.

15. Alexandroff AB, Robins RA, Murray A, James K. Tumour immunology: false hopes - new horizons? Immunol Today 1998; 19: 247-50.

16. Young LS, Eliopoulos AG, Gallagher NJ, Dawson CW. CD40 and epithelial cells: across the great divide. Immunol Today 1998; 19: 502-6.

17. Grousson J, Concha M, Schmitt D, Péguet-Navarro J. Effects of CD40 ligation on human keratinocyte accessory function. Arch Dermatol Res 1998; 290: 325-30.

18. Viac J, Schmitt D, Claudy A. CD40 expression in epidermal tumors. Anticancer Res 1997; 17: 562-72.

19. Casamayor-Palleja M, Khan M, MacLennan ICM. A subset of CD4+ memory T cells contains preformed CD40 ligand that is rapidly but transiently expressed on their surface after activation through the T cell receptor complex. J Exp Med 1995; 181: 1293-301.


Copyright © 2007 John Libbey Eurotext - Tous droits réservés